Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 2 1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 3 1
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 10 3
Lactobacillus reuteri JCM 1112 3 1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118 4 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 7 2
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
malT
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -93
score = 6.22689
sequence = TTGCGCAATCGGTTGCATTA

Gene: LVIS_0357: Predicted maltose/maltodextrin permease
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -122
score = 6.57432
sequence = TTGTGCAAACGGTTGCACAA

Gene: LAF_0024: Predicted maltose/maltodextrin permease
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -87
score = 6.2622
sequence = TCACGCAAACGCTTGCATAA

Gene: lp_1729: Predicted maltose/maltodextrin permease
*
Lactobacillus reuteri JCM 1112

Site:
position = -124
score = 6.04445
sequence = TTGCGCAAGCGGTTGCGCAA

Gene: LAR_0051: Predicted maltose/maltodextrin permease
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -117
score = 6.2622
sequence = TATCGCAAACGGTTGCAAAA

Gene: LSL_1282: Predicted maltose/maltodextrin permease
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -43
score = 5.49435
sequence = CAATGTAAACGGTTACAAAA

Gene: LEUM_0893: Predicted maltose/maltodextrin permease

Site:
position = -186
score = 6.10746
sequence = TTGTGCAAACGCTTCCATTA

Gene: LEUM_0994: Predicted maltose/maltodextrin permease
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -86
score = 6.13413
sequence = AAGTGCAAACGCTTGCACAA

Gene: PEPE_0968: Predicted maltose/maltodextrin permease
Predicted maltose/maltodextrin permease
galM
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1731: Aldose 1-epimerase
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1281: Aldose 1-epimerase
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0996: Aldose 1-epimerase
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Aldose 1-epimerase
mapA
 
Lactobacillus acidophilus NCFM

Gene: LBA1870: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0358: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0982: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0025: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2000: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0213: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus plantarum WCFS1

Gene: lp_1730: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0052: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus rhamnosus GG

Gene: LGG_00945: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1280: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0894: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)

Gene: LEUM_0995: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0967: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
pgmB
 
Lactobacillus acidophilus NCFM

Gene: LBA1869: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1925: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0983: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0026: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1999: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0214: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0053: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus rhamnosus GG

Gene: LGG_00946: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1279: Beta-phosphoglucomutase (EC 5.4.2.6)
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0895: Beta-phosphoglucomutase (EC 5.4.2.6)

Gene: LEUM_0997: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0966: Beta-phosphoglucomutase (EC 5.4.2.6)
Beta-phosphoglucomutase (EC 5.4.2.6)
 
CRON 2.
malX
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -86
score = 6.03066
sequence = TTACGAAAACGCTTGCGAAA

Site:
position = -74
score = 4.9198
sequence = TTGCGAAAGCGTTTGCACAG

Gene: lp_0175: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0176: Maltose/maltodextrin ABC transporter, permease protein 1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, permease protein 1
malD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0177: Maltose/maltodextrin ABC transporter, permease protein 2
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin ABC transporter, permease protein 2
malA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0178: Maltodextrose utilization protein MalA
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltodextrose utilization protein MalA
 
CRON 3.
malR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0356: Maltose utilization transcriptional regulator MalR, LacI family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0023: Maltose utilization transcriptional regulator MalR, LacI family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -77
score = 6.2364
sequence = TTATGCAATCGCTTGCAATA

Gene: lp_0172: Maltose utilization transcriptional regulator MalR, LacI family
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0049: Maltose utilization transcriptional regulator MalR, LacI family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1283: Maltose utilization transcriptional regulator MalR, LacI family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0891: Maltose utilization transcriptional regulator MalR, LacI family
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0969: Maltose utilization transcriptional regulator MalR, LacI family
Maltose utilization transcriptional regulator MalR, LacI family
mdxR
 
Lactobacillus acidophilus NCFM

Gene: LBA1874: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0979: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0210: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
 
Lactobacillus plantarum WCFS1

Gene: lp_0173: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0892: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
agl1
 
Lactobacillus acidophilus NCFM

Gene: LBA1872: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0309: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus casei ATCC 334

Gene: LSEI_0980: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2002: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0211: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus plantarum WCFS1

Gene: lp_0174: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Oligo-1,6-glucosidase (EC 3.2.1.10)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD