Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 3 2
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 2 2
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 3 2
Lactobacillus plantarum WCFS1 5 2
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 3 2
Lactobacillus salivarius subsp. salivarius UCC118 3 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrB
*
Lactobacillus acidophilus NCFM

Site:
position = -80
score = 6.2351
sequence = TATGATAAACGTTTGACACA

Site:
position = -168
score = 6.39299
sequence = TATGTCAATCGTTTGACACA

Gene: LBA0400: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2104: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -73
score = 5.47862
sequence = TATGCTAATCGATTGACAGC

Gene: LAF_1580: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -164
score = 5.93716
sequence = TATGTCAAGCGCTTATCATA

Site:
position = -87
score = 5.27266
sequence = ACTGTTATTCGTTTGACATA

Gene: LJ0518: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Lactobacillus plantarum WCFS1

Site:
position = -171
score = 6.00893
sequence = TATGTCAAGCGTTTGATACA

Site:
position = -82
score = 6.42881
sequence = AATGTCAAACGATTGACATA

Gene: lp_0187: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02107: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -77
score = 5.93797
sequence = AATGACATACGTTTGACATA

Site:
position = -145
score = 6.23871
sequence = TATGTCAAACGATTATCATA

Gene: LSA1793: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -81
score = 5.85375
sequence = TATGTTATACGATTGACAGT

Gene: LSL_0065: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -171
score = 6.00893
sequence = TATGTCAAGCGTTTGATACA

Site:
position = -82
score = 6.42881
sequence = AATGTCAAACGATTGACATA

Gene: PEPE_0519: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
 
Lactobacillus acidophilus NCFM

Gene: LBA0399: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1639: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1819: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0517: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus plantarum WCFS1

Gene: lp_0188: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1794: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0064: Sucrose utilization transcriptional regulator ScrR, LacI family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0520: Sucrose utilization transcriptional regulator ScrR, LacI family
Sucrose utilization transcriptional regulator ScrR, LacI family
agl4
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0189: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02696: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0521: Oligo-1,6-glucosidase (EC 3.2.1.10)
Oligo-1,6-glucosidase (EC 3.2.1.10)
 
CRON 2.
scrA
*
Lactobacillus acidophilus NCFM

Site:
position = -174
score = 6.08229
sequence = TGTGTCAAACGTTTATCATA

Site:
position = -86
score = 6.51618
sequence = TGTGTCAAACGATTGACATA

Gene: LBA0401: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -106
score = 5.94762
sequence = TATGTCAAACGGTTGACAAT

Gene: LAF_1578: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -91
score = 6.09441
sequence = TATGATAAGCGCTTGACATA

Site:
position = -168
score = 5.74614
sequence = TATGTCAAACGAATAACAGT

Gene: LJ0519: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Lactobacillus plantarum WCFS1

Site:
position = -193
score = 6.47461
sequence = TATGTCAATCGTTTGACATT

Site:
position = -104
score = 6.06215
sequence = TGTATCAAACGCTTGACATA

Gene: lp_0185: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -169
score = 6.05288
sequence = TATGTCAAACGTATGTCATT

Site:
position = -101
score = 6.27721
sequence = TATGATAATCGTTTGACATA

Gene: LSA1792: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -107
score = 6.19044
sequence = TGTGATAAACGATTGACATA

Gene: LSL_0066: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -104
score = 6.06215
sequence = TGTATCAAACGCTTGACATA

Site:
position = -193
score = 6.47461
sequence = TATGTCAATCGTTTGACATT

Gene: PEPE_0518: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
agaB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2079: Alpha-galactosidase (EC 3.2.1.22)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02079: Alpha-galactosidase (EC 3.2.1.22)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1795: Alpha-galactosidase (EC 3.2.1.22)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0517: Alpha-galactosidase (EC 3.2.1.22)
Alpha-galactosidase (EC 3.2.1.22)
scrK
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0184: Fructokinase (EC 2.7.1.4)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0516: Fructokinase (EC 2.7.1.4)
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD