Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 4 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124 4 2
Streptococcus equi subsp. zooepidemicus MGCS10565 3 2
Streptococcus gallolyticus UCN34 4 2
Streptococcus gordonii str. Challis substr. CH1 3 2
Streptococcus mitis B6 4 2
Streptococcus mutans UA159 3 2
Streptococcus pneumoniae TIGR4 4 2
Streptococcus pyogenes M1 GAS 3 2
Streptococcus sanguinis SK36 4 2
Streptococcus suis 05ZYH33 4 2
Streptococcus thermophilus CNRZ1066 5 2
Streptococcus uberis 0140J 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -111
score = 6.83501
sequence = TATGTCAAGCGTTTGACATA

Gene: SAG1691: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -110
score = 6.83501
sequence = TATGTCAAGCGTTTGACATA

Gene: SDEG_1872: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -113
score = 6.83501
sequence = TATGTCAAGCGTTTGACATA

Gene: Sez_0362: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus gallolyticus UCN34

Site:
position = -109
score = 6.30626
sequence = TATGTCAAGCGTTTATCATA

Gene: GALLO_1893: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -111
score = 6.22844
sequence = TATGTCAAGCGTTTTGCAGA

Gene: SGO_1858: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus mitis B6

Site:
position = -108
score = 5.99038
sequence = TATGATAAACGTTTGACAGT

Gene: smi_1616: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus mutans UA159

Site:
position = -112
score = 6.40526
sequence = TATGTCAATCGTTTTACATA

Gene: SMU.1843: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus pneumoniae TIGR4

Site:
position = -286
score = 6.22844
sequence = TATGTCAAGCGTTTTGCAGA

Gene: SP_1724: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus pyogenes M1 GAS

Site:
position = -109
score = 6.12399
sequence = TATGTCAAGCGCCTAACATA

Gene: SPy1816: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus sanguinis SK36

Site:
position = -110
score = 6.22844
sequence = TATGTCAAGCGTTTTGCAGA

Gene: SSA_0455: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus suis 05ZYH33

Site:
position = -1
score = 5.95417
sequence = TATGTCAAACGTTTATCACA

Gene: SSU05_1818: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -106
score = 6.16559
sequence = TATGTCAAACGTTTAGCATT

Site:
position = -52
score = 5.24352
sequence = TAGGTAAAACGTTTACTATA

Gene: str1735: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Streptococcus uberis 0140J

Site:
position = -108
score = 6.83501
sequence = TATGTCAAGCGTTTGACATA

Gene: SUB1544: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1692: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1873: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0361: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1894: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1859: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus mitis B6

Gene: smi_1617: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus mutans UA159

Gene: SMU.1844: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus pneumoniae TIGR4

Gene: SP_1725: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus pyogenes M1 GAS

Gene: SPy1817: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus sanguinis SK36

Gene: SSA_0454: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus suis 05ZYH33

Gene: SSU05_1819: Sucrose utilization regulator ScrR, LacI family
 2
Streptococcus thermophilus CNRZ1066

Gene: str1736: Sucrose utilization regulator ScrR, LacI family

Gene: str1737: Sucrose utilization regulator ScrR, LacI family
 
Streptococcus uberis 0140J

Gene: SUB1545: Sucrose utilization regulator ScrR, LacI family
Sucrose utilization regulator ScrR, LacI family
 
CRON 2.
scrA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -93
score = 6.82569
sequence = TATGTCAAACGCTTGACATA

Gene: SAG1690: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -152
score = 6.82569
sequence = TATGTCAAACGCTTGACATA

Gene: SDEG_1871: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -185
score = 6.82569
sequence = TATGTCAAACGCTTGACATA

Gene: Sez_0363: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus gallolyticus UCN34

Site:
position = -109
score = 6.43411
sequence = TATGATAAACGCTTGACATA

Gene: GALLO_1892: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -108
score = 6.19981
sequence = TCTGCAAAACGCTTGACATA

Gene: SGO_1857: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus mitis B6

Site:
position = -108
score = 6.19981
sequence = TCTGCAAAACGCTTGACATA

Gene: smi_1615: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus mutans UA159

Site:
position = -103
score = 6.3677
sequence = TATGTAAAACGATTGACATA

Gene: SMU.1841: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus pneumoniae TIGR4

Site:
position = -109
score = 6.19981
sequence = TCTGCAAAACGCTTGACATA

Gene: SP_1722: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus pyogenes M1 GAS

Site:
position = -152
score = 6.1668
sequence = TATGTTAGGCGCTTGACATA

Gene: SPy1815: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus sanguinis SK36

Site:
position = -104
score = 6.19981
sequence = TCTGCAAAACGCTTGACATA

Gene: SSA_0456: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus suis 05ZYH33

Site:
position = -107
score = 6.07778
sequence = TGTGATAAACGTTTGACATA

Gene: SSU05_1817: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -156
score = 6.08415
sequence = AATGCTAAACGTTTGACATA

Gene: str1734: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Streptococcus uberis 0140J

Site:
position = -96
score = 6.82569
sequence = TATGTCAAACGCTTGACATA

Gene: SUB1543: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrK
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1689: Fructokinase (EC 2.7.1.4)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1870: Fructokinase (EC 2.7.1.4)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0365: Fructokinase (EC 2.7.1.4)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1891: Fructokinase (EC 2.7.1.4)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1755: Fructokinase (EC 2.7.1.4)
 
Streptococcus mitis B6

Gene: smi_1614: Fructokinase (EC 2.7.1.4)
 
Streptococcus mutans UA159

Gene: SMU.1840: Fructokinase (EC 2.7.1.4)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1721: Fructokinase (EC 2.7.1.4)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1811: Fructokinase (EC 2.7.1.4)
 
Streptococcus sanguinis SK36

Gene: SSA_0457: Fructokinase (EC 2.7.1.4)
 
Streptococcus suis 05ZYH33

Gene: SSU05_1816: Fructokinase (EC 2.7.1.4)
 
Streptococcus thermophilus CNRZ1066

Gene: str1733: Fructokinase (EC 2.7.1.4)
 2
Streptococcus uberis 0140J

Gene: SUB1542: Fructokinase (EC 2.7.1.4)

Gene: SUB0308: Fructokinase (EC 2.7.1.4)
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD