Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 4 2
Lactococcus lactis subsp. lactis Il1403 4 2
Streptococcus agalactiae 2603V/R 10 6
Streptococcus dysgalactiae subsp. equisimilis GGS_124 8 4
Streptococcus equi subsp. zooepidemicus MGCS10565 10 6
Streptococcus gallolyticus UCN34 11 7
Streptococcus gordonii str. Challis substr. CH1 11 5
Streptococcus mitis B6 11 7
Streptococcus mutans UA159 8 4
Streptococcus pneumoniae TIGR4 9 6
Streptococcus pyogenes M1 GAS 10 6
Streptococcus sanguinis SK36 11 6
Streptococcus suis 05ZYH33 14 4
Streptococcus thermophilus CNRZ1066 3 2
Streptococcus uberis 0140J 8 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dexB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1851: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L128693: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
*
Streptococcus agalactiae 2603V/R

Site:
position = -75
score = 5.93037
sequence = TTACGCAAACGCTTGCACTA

Gene: SAG1924: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0236: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -126
score = 5.7575
sequence = AAATGCAAGCGATTGCGCTA

Gene: Sez_1771: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
*
Streptococcus gallolyticus UCN34

Site:
position = -72
score = 6.01881
sequence = TAACGCAAACGCTTGCGCAA

Gene: GALLO_0196: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Streptococcus gordonii str. Challis substr. CH1
*
Streptococcus mitis B6

Site:
position = -75
score = 6.05162
sequence = TTAGGCAAACGCTTGCATAA

Gene: smi_1761: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Streptococcus mutans UA159

Gene: SMU.883: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
*
Streptococcus pneumoniae TIGR4

Site:
position = -75
score = 5.79374
sequence = TTAAGCAAACGCTTGCACAA

Gene: SP_0342: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
*
Streptococcus pyogenes M1 GAS

Site:
position = -75
score = 5.77579
sequence = TTGCGCAAACGATTGCACAA

Gene: SPy1973: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1554: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB0246: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
 
CRON 2.
amyA2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG0708: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0546: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1409: Cytoplasmic alpha-amylase (EC 3.2.1.1)
*
Streptococcus gallolyticus UCN34

Site:
position = -74
score = 6.24597
sequence = TTACGCAAACGCTTGCGTTA

Gene: GALLO_1043: Cytoplasmic alpha-amylase (EC 3.2.1.1)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -105
score = 5.21762
sequence = CGACGCAAACGTTTGCGTCC

Gene: SGO_1075: Cytoplasmic alpha-amylase (EC 3.2.1.1)
*
Streptococcus mitis B6

Site:
position = -74
score = 5.8976
sequence = TTACGCAAACGTTTGAGTAA

Gene: smi_0750: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus mutans UA159

Gene: SMU.1590: Cytoplasmic alpha-amylase (EC 3.2.1.1)
*
Streptococcus pneumoniae TIGR4

Site:
position = -74
score = 6.17564
sequence = TTACGCAAACGTTTGCGCTA

Gene: SP_1382: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus pyogenes M1 GAS
*
Streptococcus sanguinis SK36

Site:
position = -58
score = 5.11216
sequence = AGACGCAAACGATTGCGCCT

Gene: SSA_1024: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str1542: Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
Streptococcus uberis 0140J

Gene: SUB0537: Cytoplasmic alpha-amylase (EC 3.2.1.1)
Cytoplasmic alpha-amylase (EC 3.2.1.1)
 
CRON 3.
rgfB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1958: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0223: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1782: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0150: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0506: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus mitis B6

Gene: smi_1403: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus mutans UA159

Gene: SMU.2046c: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0760: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1985: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus sanguinis SK36

Gene: SSA_1808: Exodeoxyribonuclease III (EC 3.1.11.2)
*
Streptococcus suis 05ZYH33

Site:
position = -40
score = 4.79951
sequence = AAAAGAAAACGGTTACGCAT

Site:
position = -72
score = 5.80734
sequence = TAATGCAAACGTTTACGCTA

Gene: SSU05_0396: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus thermophilus CNRZ1066

Gene: str0193: Exodeoxyribonuclease III (EC 3.1.11.2)
 
Streptococcus uberis 0140J

Gene: SUB0237: Exodeoxyribonuclease III (EC 3.1.11.2)
Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -45
score = 5.93037
sequence = TAACGCAAACGCTTGCACTA

Gene: SAG1959: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -103
score = 6.5386
sequence = TAACGCAAACGTTTGCGTAA

Gene: SDEG_0222: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -108
score = 6.08679
sequence = AAGCGCAAACGTTTGCGTTA

Gene: Sez_1783: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus gallolyticus UCN34

Site:
position = -132
score = 6.28092
sequence = CAACGCAAACGTTTGCGTAA

Gene: GALLO_0149: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -49
score = 5.55469
sequence = CAATGCAAACGATTTCATAT

Site:
position = -290
score = 5.25701
sequence = TCACGCAATCGTTTGCTTAA

Gene: SGO_0505: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus mitis B6

Site:
position = -54
score = 5.92757
sequence = AAGTGCAAACGTTTTCGTAA

Gene: smi_1404: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus mutans UA159

Site:
position = -45
score = 6.05471
sequence = AAATGCAAACGTTTGCATGA

Gene: SMU.2047: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus pneumoniae TIGR4

Site:
position = -54
score = 5.92757
sequence = AAGTGCAAACGTTTTCGTAA

Gene: SP_0758: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus pyogenes M1 GAS

Site:
position = -103
score = 5.61677
sequence = CAATGCAAGCGATTGCATCA

Gene: SPy1986: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus sanguinis SK36

Site:
position = -56
score = 5.46808
sequence = ACATGCAAACGATTTCACAA

Site:
position = -195
score = 4.99958
sequence = TCATGCAATCGTTTTCGTTG

Gene: SSA_1809: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 2
Streptococcus suis 05ZYH33

Gene: SSU05_0397: PTS system glucose-specific EIICBA component (EC 2.7.1.69)

Gene: SSU05_0398: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 4
Streptococcus thermophilus CNRZ1066

Gene: str0189: PTS system glucose-specific EIICBA component (EC 2.7.1.69)

Gene: str0192: PTS system glucose-specific EIICBA component (EC 2.7.1.69)

Gene: str0190: PTS system glucose-specific EIICBA component (EC 2.7.1.69)

Gene: str0191: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
*
Streptococcus uberis 0140J

Site:
position = -70
score = 6.44489
sequence = AAACGCAAACGTTTGCGTAA

Gene: SUB0236: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
 
CRON 4.
nepU
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -191
score = 5.6724
sequence = ATTCGCAAACGGTTGCGTCA

Gene: LACR_1852: Neopullulanase (EC 3.2.1.135)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -187
score = 5.5262
sequence = TGTCGCAAACGGTTGCGTCA

Gene: L128694: Neopullulanase (EC 3.2.1.135)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1304: Neopullulanase (EC 3.2.1.135)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1265: Neopullulanase (EC 3.2.1.135)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0753: Neopullulanase (EC 3.2.1.135)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -52
score = 5.69763
sequence = TTATGAAAACGTTTGCTTTA

Gene: SGO_1351: Neopullulanase (EC 3.2.1.135)
*
Streptococcus mitis B6

Site:
position = -51
score = 6.30734
sequence = TTATGAAAACGTTTGCGTAA

Gene: smi_1104: Neopullulanase (EC 3.2.1.135)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1304: Neopullulanase (EC 3.2.1.135)
 
Streptococcus sanguinis SK36

Gene: SSA_1457: Neopullulanase (EC 3.2.1.135)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Neopullulanase (EC 3.2.1.135)
 
CRON 5.
pulA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -67
score = 5.54873
sequence = TGTTGCAAGCGCTTGCGTAA

Gene: SAG1216: Pullulanase (EC 3.2.1.41)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -67
score = 6.01337
sequence = TATTGCAAGCGTTTGCGTAA

Gene: SDEG_0237: Pullulanase (EC 3.2.1.41)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -77
score = 5.24005
sequence = CAAAGAAAACGATTGCACTA

Gene: Sez_0820: Pullulanase (EC 3.2.1.41)
*
Streptococcus gallolyticus UCN34

Site:
position = -85
score = 6.01803
sequence = TTACGAAAACGCTTGCGTAA

Gene: GALLO_1462: Pullulanase (EC 3.2.1.41)
 
Streptococcus gordonii str. Challis substr. CH1
*
Streptococcus mitis B6

Site:
position = -72
score = 4.9041
sequence = TCGAGAAAACGCTTGCATAT

Gene: smi_1848: Pullulanase (EC 3.2.1.41)
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -72
score = 5.21372
sequence = CAAAGAAAACGCTTGCATAT

Gene: SP_0268: Pullulanase (EC 3.2.1.41)
*
Streptococcus pyogenes M1 GAS

Site:
position = -66
score = 5.21649
sequence = TCTTGCAAGCGCTTGCGCAA

Gene: SPy1972: Pullulanase (EC 3.2.1.41)
*
Streptococcus sanguinis SK36

Site:
position = -58
score = 5.24901
sequence = TACAGAAAACGTTTGCATAG

Gene: SSA_0453: Pullulanase (EC 3.2.1.41)
 
Streptococcus suis 05ZYH33

Gene: SSU05_2064: Pullulanase (EC 3.2.1.41)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Pullulanase (EC 3.2.1.41)
 
CRON 6.
malE
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -68
score = 6.14485
sequence = AAAAGCAAACGGTTGCGTAA

Gene: LACR_1853: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -68
score = 5.61775
sequence = AAAAGCAAACGGTTGTGTAA

Gene: L128695: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus agalactiae 2603V/R

Site:
position = -60
score = 6.12934
sequence = TTTTGCAAACGGTTGCATAA

Gene: SAG1441: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -58
score = 5.99066
sequence = TTCTGCAAGCGGTTGCATAA

Gene: SDEG_1296: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -58
score = 5.99066
sequence = TTCTGCAAGCGGTTGCATAA

Gene: Sez_1257: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus gallolyticus UCN34

Site:
position = -68
score = 5.94558
sequence = TCCTGCAAACGGTTGCATAA

Gene: GALLO_1399: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -66
score = 6.00326
sequence = TTTCGCAAACGATTGCATAA

Gene: SMU.1568: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus pneumoniae TIGR4
*
Streptococcus pyogenes M1 GAS

Site:
position = -58
score = 5.99066
sequence = TTCTGCAAGCGGTTGCATAA

Gene: SPy1294: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus sanguinis SK36

Site:
position = -56
score = 6.03563
sequence = AATTGCAAACGGTTGCATAA

Gene: SSA_1298: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
*
Streptococcus uberis 0140J

Site:
position = -55
score = 6.22267
sequence = TTCTGCAAACGGTTGCATAA

Gene: SUB1143: Maltose/maltodextrin ABC transporter, substrate-binding protein
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1854: Maltose/maltodextrin ABC transporter, permease protein 1
 
Lactococcus lactis subsp. lactis Il1403

Gene: L128696: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus agalactiae 2603V/R

Gene: SAG1442: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1297: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1258: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1400: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1569: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1295: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus sanguinis SK36

Gene: SSA_1299: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1144: Maltose/maltodextrin ABC transporter, permease protein 1
Maltose/maltodextrin ABC transporter, permease protein 1
malG
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1855: Maltose/maltodextrin ABC transporter, permease protein 2
 
Lactococcus lactis subsp. lactis Il1403

Gene: L128697: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus agalactiae 2603V/R

Gene: SAG1443: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1298: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1259: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1401: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.1570: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1296: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus sanguinis SK36

Gene: SSA_1300: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J

Gene: SUB1145: Maltose/maltodextrin ABC transporter, permease protein 2
Maltose/maltodextrin ABC transporter, permease protein 2
 
CRON 7.
malM
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
*
Streptococcus agalactiae 2603V/R

Site:
position = -61
score = 5.84786
sequence = TTATGCAATCGCTTGCGTTA

Gene: SAG1439: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -59
score = 6.37519
sequence = TTACGCAAACGGTTGCGTTA

Gene: SDEG_1293: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -84
score = 6.08499
sequence = TTGCGCAAACGGTTGCGTTA

Gene: Sez_1255: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus gallolyticus UCN34

Site:
position = -60
score = 6.08013
sequence = TTACGCAAACGGTTGCGCTA

Gene: GALLO_1397: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -278
score = 5.70509
sequence = TTACGCAAACGTTTTCTTAA

Site:
position = -64
score = 5.41711
sequence = CTACGCAAACGTTTTCGTTG

Gene: SGO_0105: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus mitis B6

Site:
position = -273
score = 5.04921
sequence = TTGAGAAAACGATTGCCTAA

Site:
position = -63
score = 5.96649
sequence = TAACGCAAACGTTTGCGTTC

Gene: smi_0134: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus mutans UA159

Site:
position = -61
score = 6.37827
sequence = TTATGCAAACGATTGCGTTA

Gene: SMU.1565: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus pneumoniae TIGR4

Site:
position = -65
score = 5.89785
sequence = TAACGCAAACGTTTGCGTCT

Gene: SP_2107: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus pyogenes M1 GAS

Site:
position = -58
score = 6.01396
sequence = TTACGCAAGCGCTTGCGTTA

Gene: SPy1292: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus sanguinis SK36

Site:
position = -251
score = 4.89644
sequence = AAACGCAAACGTTTTCTGTT

Site:
position = -64
score = 5.95258
sequence = CGACGCAAACGTTTGCATTA

Gene: SSA_2266: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*4
Streptococcus suis 05ZYH33

Gene: SSU05_0393: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)

Site:
position = -260
score = 5.41489
sequence = TTGCGCAAACGTTTTCCTAA

Site:
position = -46
score = 5.08221
sequence = AAGAGAAAACGTTTGCGTTG

Gene: SSU05_2132: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)

Gene: SSU05_2131: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)

Site:
position = -57
score = 6.15137
sequence = AAGTGCAAACGTTTGCGTTA

Gene: SSU05_0392: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus thermophilus CNRZ1066

Site:
position = -57
score = 5.64142
sequence = ACGTGCAACCGTTTGCATTA

Gene: str1013: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
*
Streptococcus uberis 0140J

Site:
position = -56
score = 6.37519
sequence = TTACGCAAACGGTTGCGTTA

Gene: SUB1141: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R

Gene: SAG1438: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1292: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1254: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1396: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0106: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus mitis B6

Gene: smi_0135: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus mutans UA159

Gene: SMU.1564: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus pneumoniae TIGR4

Gene: SP_2106: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1291: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus sanguinis SK36

Gene: SSA_2265: Maltodextrin phosphorylase (EC 2.4.1.1)
 3
Streptococcus suis 05ZYH33

Gene: SSU05_1444: Maltodextrin phosphorylase (EC 2.4.1.1)

Gene: SSU05_1443: Maltodextrin phosphorylase (EC 2.4.1.1)

Gene: SSU05_0394: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus thermophilus CNRZ1066

Gene: str1012: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Streptococcus uberis 0140J

Gene: SUB1140: Maltodextrin phosphorylase (EC 2.4.1.1)
Maltodextrin phosphorylase (EC 2.4.1.1)
 
CRON 8.
malX
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1305: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1266: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0754: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -280
score = 5.48087
sequence = CAACGAAAACGTTTGCGTAG

Site:
position = -66
score = 6.03823
sequence = TTAAGAAAACGTTTGCGTAA

Gene: SGO_0104: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus mitis B6

Site:
position = -61
score = 5.51787
sequence = AAAGGAAAACGTTTGCGTTT

Gene: smi_0133: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -61
score = 5.51787
sequence = AAAGGAAAACGTTTGCGTTT

Gene: SP_2108: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus pyogenes M1 GAS

Gene: SPy1306: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus sanguinis SK36
*
Streptococcus suis 05ZYH33

Site:
position = -62
score = 5.70599
sequence = TTAGGAAAACGTTTGCGCAA

Gene: SSU05_2133: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1302: Maltose/maltodextrin ABC transporter, permease protein 1

Gene: SDEG_1303: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1263: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0755: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0103: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus mitis B6

Gene: smi_0132: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2109: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus pyogenes M1 GAS

Gene: SPy1301: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2134: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, permease protein 1
malD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1301: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0756: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0102: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus mitis B6

Gene: smi_0131: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2110: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus pyogenes M1 GAS

Gene: SPy1299: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2135: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, permease protein 2
malA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1300: Maltodextrose utilization protein MalA
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1260: Maltodextrose utilization protein MalA
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0101: Maltodextrose utilization protein MalA
 
Streptococcus mitis B6

Gene: smi_0130: Maltodextrose utilization protein MalA
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2111: Maltodextrose utilization protein MalA
 
Streptococcus pyogenes M1 GAS

Gene: SPy1298: Maltodextrose utilization protein MalA
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2136: Maltodextrose utilization protein MalA
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltodextrose utilization protein MalA
malR
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1846: Maltose utilization transcriptional regulator MalR, LacI family
 
Lactococcus lactis subsp. lactis Il1403

Gene: L0144: Maltose utilization transcriptional regulator MalR, LacI family
*
Streptococcus agalactiae 2603V/R

Site:
position = -215
score = 6.04485
sequence = TTATGCAACCGTTTGCAAAA

Gene: SAG1440: Maltose utilization transcriptional regulator MalR, LacI family
 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_0221: Maltose utilization transcriptional regulator MalR, LacI family

Gene: SDEG_1294: Maltose utilization transcriptional regulator MalR, LacI family
*2
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1784: Maltose utilization transcriptional regulator MalR, LacI family

Site:
position = -210
score = 5.82012
sequence = TTATGCAACCGCTTGCAGAA

Gene: Sez_1256: Maltose utilization transcriptional regulator MalR, LacI family
*2
Streptococcus gallolyticus UCN34

Gene: GALLO_0148: Maltose utilization transcriptional regulator MalR, LacI family

Site:
position = -270
score = 5.61062
sequence = TTATGCAACCGTTTGCAGGA

Site:
position = -123
score = 5.21024
sequence = AAAAGCAAACAATTGCAGAA

Gene: GALLO_1398: Maltose utilization transcriptional regulator MalR, LacI family
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0100: Maltose utilization transcriptional regulator MalR, LacI family
 
Streptococcus mitis B6

Gene: smi_0129: Maltose utilization transcriptional regulator MalR, LacI family
*
Streptococcus mutans UA159

Site:
position = -200
score = 5.81501
sequence = TTATGCAATCGTTTGCGAAA

Gene: SMU.1566: Maltose utilization transcriptional regulator MalR, LacI family
 
Streptococcus pneumoniae TIGR4

Gene: SP_2112: Maltose utilization transcriptional regulator MalR, LacI family
*
Streptococcus pyogenes M1 GAS

Site:
position = -207
score = 5.82012
sequence = TTATGCAACCGCTTGCAGAA

Gene: SPy1293: Maltose utilization transcriptional regulator MalR, LacI family
*
Streptococcus sanguinis SK36

Site:
position = -204
score = 5.29058
sequence = AACAGAAAACGTTTGCGTTT

Gene: SSA_2267: Maltose utilization transcriptional regulator MalR, LacI family
 
Streptococcus suis 05ZYH33

Gene: SSU05_2137: Maltose utilization transcriptional regulator MalR, LacI family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -109
score = 5.25568
sequence = TTATGAAACCGTTATCATAA

Gene: str1014: Maltose utilization transcriptional regulator MalR, LacI family
*2
Streptococcus uberis 0140J

Gene: SUB0235: Maltose utilization transcriptional regulator MalR, LacI family

Site:
position = -161
score = 6.04485
sequence = TTATGCAACCGTTTGCAGAA

Gene: SUB1142: Maltose utilization transcriptional regulator MalR, LacI family
Maltose utilization transcriptional regulator MalR, LacI family
pulA2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0099: Pullulanase (EC 3.2.1.41)
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_2268: Pullulanase (EC 3.2.1.41)
 
Streptococcus suis 05ZYH33

Gene: SSU05_2138: Pullulanase (EC 3.2.1.41)
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Pullulanase (EC 3.2.1.41)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD