Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CopR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 4 1
Lactobacillus brevis ATCC 367 4 2
Lactobacillus casei ATCC 334 5 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 3 1
Lactobacillus fermentum IFO 3956 4 2
Lactobacillus helveticus DPC 4571 5 2
Lactobacillus johnsonii NCC 533 4 1
Lactobacillus plantarum WCFS1 2 2
Lactobacillus reuteri JCM 1112 4 2
Lactobacillus rhamnosus GG 2 1
Lactobacillus sakei subsp. sakei 23K 2 1
Lactobacillus salivarius subsp. salivarius UCC118 3 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 2 1
Oenococcus oeni PSU-1 2 1
Pediococcus pentosaceus ATCC 25745 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copR
*
Lactobacillus acidophilus NCFM

Site:
position = -32
score = 6.07433
sequence = ATAGTTACATTTGTAAACGA

Gene: LBA1963: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus brevis ATCC 367

Site:
position = -68
score = 5.40928
sequence = ATGACTACAGATGTAGACTC

Site:
position = -35
score = 6.0317
sequence = AAGATTACATTTGTAGTCTA

Gene: LVIS_0270: Copper transport transcriptional regulator CopR, CopY family
*2
Lactobacillus casei ATCC 334

Site:
position = -29
score = 6.06101
sequence = TAGATTACAGATGTAAACGG

Site:
position = -59
score = 4.95698
sequence = TGGTTTACAGTTGTAAATTA

Gene: LSEI_1745: Copper transport transcriptional regulator CopR, CopY family

Site:
position = -46
score = 4.57725
sequence = GAGACTACAAACGTAAACTT

Site:
position = -77
score = 5.38976
sequence = GTGACTACAGTTGTAAACTA

Gene: LSEI_A02: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -31
score = 6.01919
sequence = AAGGTTATAGATGTAAACGA

Site:
position = -72
score = 4.7991
sequence = TTGTCGACAAATGTAAACCA

Gene: LBUL_0587: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus fermentum IFO 3956

Site:
position = -42
score = 4.56108
sequence = ACGGGTACACTTGTAAACTG

Gene: LAF_1037: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus helveticus DPC 4571

Site:
position = -32
score = 6.26191
sequence = ATATTTACAAATGTAAACTA

Site:
position = -59
score = 5.34835
sequence = AAGTTTACAAATGTAAAATT

Gene: lhv_2094: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus johnsonii NCC 533

Site:
position = -61
score = 5.37472
sequence = TTGTTGACAAGTGTAAACTA

Site:
position = -33
score = 6.33884
sequence = ATGATTACATTTGTAAACGA

Gene: LJ1835: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus plantarum WCFS1

Site:
position = -52
score = 5.19779
sequence = ACGTTTACGGTTGTAAACTA

Gene: lp_3365: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus reuteri JCM 1112

Site:
position = -32
score = 5.10309
sequence = GAATTTACATGTGTAAACGC

Gene: LAR_0894: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus rhamnosus GG

Site:
position = -29
score = 6.21098
sequence = AAGATTACAAGTGTAAACGG

Site:
position = -59
score = 4.95698
sequence = TCGTTTACAGTTGTAAATTA

Gene: LGG_01802: Copper transport transcriptional regulator CopR, CopY family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -35
score = 6.4399
sequence = ATAATTACAAATGTAAACGA

Gene: LSA1461: Copper transport transcriptional regulator CopR, CopY family
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1318: Copper transport transcriptional regulator CopR, CopY family
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -25
score = 5.92004
sequence = TAGTTTACAGTTGTAGACTA

Gene: LEUM_0049: Copper transport transcriptional regulator CopR, CopY family
*
Oenococcus oeni PSU-1

Site:
position = -30
score = 5.8306
sequence = AAGTCTACAAGTGTAGACTA

Gene: OEOE_1648: Copper transport transcriptional regulator CopR, CopY family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -35
score = 5.92558
sequence = AAGATTACATTTGTAAACAG

Site:
position = -61
score = 6.11324
sequence = AAGTTTACAAATGTAGTCTA

Gene: PEPE_1646: Copper transport transcriptional regulator CopR, CopY family
Copper transport transcriptional regulator CopR, CopY family
copA2
 
Lactobacillus acidophilus NCFM

Gene: LBA1964: Copper-exporting ATPase (EC 3.6.3.4)
*
Lactobacillus brevis ATCC 367

Site:
position = -139
score = 5.67733
sequence = AGGATTACATTTGTAAACAA

Site:
position = -184
score = 5.13496
sequence = TCGTTGACAGATGTAAACGA

Gene: LVIS_0274: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0588: Copper-exporting ATPase (EC 3.6.3.4)
*
Lactobacillus fermentum IFO 3956

Site:
position = -80
score = 4.86402
sequence = TCGTTGACAATTGTAAACGG

Site:
position = -35
score = 5.73812
sequence = AGATTTACAGTTGTAAACGA

Gene: LAF_0138: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2095: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus johnsonii NCC 533

Gene: LJ1836: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus plantarum WCFS1
*
Lactobacillus reuteri JCM 1112

Site:
position = -70
score = 4.55216
sequence = TTGTTGACAACTGTAAACTT

Site:
position = -27
score = 6.35405
sequence = ATGATTACAATTGTAAACTA

Gene: LAR_0423: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -35
score = 5.36788
sequence = GTGATTACAAATGTAAATTA

Gene: LSL_1706: Copper-exporting ATPase (EC 3.6.3.4)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Copper-exporting ATPase (EC 3.6.3.4)
copA3
 
Lactobacillus acidophilus NCFM

Gene: LBA1965: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0139: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2096: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus johnsonii NCC 533

Gene: LJ1837: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0424: Copper-exporting ATPase (EC 3.6.3.4)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1705: Copper-exporting ATPase (EC 3.6.3.4)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Copper-exporting ATPase (EC 3.6.3.4)
copA
 
Lactobacillus acidophilus NCFM

Gene: LBA1966: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0273: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0589: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0140: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_2097: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus johnsonii NCC 533

Gene: LJ1838: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0425: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1704: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Copper-translocating P-type ATPase (EC 3.6.3.4)
LSEI_1744
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_1744: Hypothetical protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Hypothetical protein
copB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0269: Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Lactobacillus casei ATCC 334

Gene: LSEI_1743: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: LSEI_A01: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1157: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -177
score = 5.38976
sequence = GTGACTACAGTTGTAAACTA

Site:
position = -146
score = 5.14339
sequence = GAGACTACAAATGTAAACTT

Gene: lhv_1944: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -43
score = 5.85297
sequence = TAAATTACAGATGTAGACAA

Site:
position = -69
score = 4.72189
sequence = TCGTCTACAATTGTAAACTT

Gene: lp_3363: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01801: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1460: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0048: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Oenococcus oeni PSU-1

Gene: OEOE_1647: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1645: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD