Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CopR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11 10 6
Lactococcus lactis subsp. lactis Il1403 10 5
Streptococcus agalactiae 2603V/R 3 1
Streptococcus dysgalactiae subsp. equisimilis GGS_124 4 1
Streptococcus equi subsp. zooepidemicus MGCS10565 2 1
Streptococcus gallolyticus UCN34 3 1
Streptococcus gordonii str. Challis substr. CH1 6 2
Streptococcus mitis B6 3 1
Streptococcus mutans UA159 3 1
Streptococcus pneumoniae TIGR4 3 1
Streptococcus pyogenes M1 GAS 3 1
Streptococcus sanguinis SK36 3 1
Streptococcus suis 05ZYH33 3 1
Streptococcus thermophilus CNRZ1066 3 1
Streptococcus uberis 0140J 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cinD
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -72
score = 6.21831
sequence = TAGTTTACAAGTGTAAATTT

Site:
position = -45
score = 5.59429
sequence = AAGATTACAGATGTAAACAA

Gene: LACR_2184: Copper-induced nitroreductase
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -73
score = 6.21831
sequence = TAGTTTACAAGTGTAAATTT

Site:
position = -46
score = 5.64158
sequence = AAGATTACATATGTAAACAA

Gene: L174788: Copper-induced nitroreductase
 
Streptococcus agalactiae 2603V/R

Gene: SAG1909: Copper-induced nitroreductase
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.260: Copper-induced nitroreductase
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_1952: Copper-induced nitroreductase
 
Streptococcus thermophilus CNRZ1066

Gene: str1363: Copper-induced nitroreductase
 
Streptococcus uberis 0140J
Copper-induced nitroreductase
 
CRON 2.
copR
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -53
score = 5.04187
sequence = GTGTTTACGCGTGTAAACTT

Gene: LACR_0889: Copper transport transcriptional regulator CopR, CopY family
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -53
score = 5.51604
sequence = GTGTTTACACGTGTAAACTT

Gene: L45109: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus agalactiae 2603V/R

Site:
position = -34
score = 5.2971
sequence = TGGTTTACAAACGTAAATCG

Site:
position = -66
score = 5.77667
sequence = CGGTTTACAAATGTAGATTT

Gene: SAG0384: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -41
score = 6.34542
sequence = TAATTTACAAATGTAAATTA

Site:
position = -73
score = 5.72076
sequence = TTATTTACAAATGTAGTTAA

Gene: SDEG_1771: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -65
score = 6.23473
sequence = TTGTTTACAAATGTAAACAA

Gene: Sez_0447: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus gallolyticus UCN34

Site:
position = -43
score = 5.67741
sequence = AAATCTACAAATGTAAATCA

Site:
position = -75
score = 5.64334
sequence = TCGTTGACAAATGTAAACGA

Gene: GALLO_0378: Copper transport transcriptional regulator CopR, CopY family
*2
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -75
score = 6.12802
sequence = TTGTTTACAAATGTAAATGT

Site:
position = -34
score = 6.02419
sequence = AGATTTACAAATGTAGATTT

Gene: SGO_0289: Copper transport transcriptional regulator CopR, CopY family

Site:
position = -66
score = 5.73651
sequence = GCGATTACAAATGTAAACTA

Site:
position = -37
score = 5.89132
sequence = TGAATTACAAATGTAAATAA

Gene: SGO_1935: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus mitis B6

Site:
position = -33
score = 5.98501
sequence = TAATTGACAAATGTAGATTT

Site:
position = -73
score = 6.04341
sequence = TAGTTGACAAATGTAGATTT

Gene: smi_1434: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus mutans UA159

Site:
position = -31
score = 5.42485
sequence = GTATCTACAAATGTAGATGA

Site:
position = -63
score = 5.84815
sequence = TTGTTGACAAATGTAGACAA

Gene: SMU.424: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus pneumoniae TIGR4

Site:
position = -27
score = 5.98501
sequence = TAATTGACAAATGTAGATTT

Site:
position = -67
score = 5.98501
sequence = TAATTGACAAATGTAGATTT

Gene: SP_0727: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus pyogenes M1 GAS

Site:
position = -41
score = 5.94376
sequence = TAATTTACAAACGTAAATAT

Site:
position = -73
score = 5.72076
sequence = TTATTTACAAATGTAGTTAA

Gene: SPy1717: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus sanguinis SK36

Site:
position = -66
score = 5.89132
sequence = ACGATTACAAATGTAAACTA

Site:
position = -37
score = 5.91704
sequence = TAGATTACAAATGTAAATGA

Gene: SSA_0139: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus suis 05ZYH33

Site:
position = -34
score = 5.5369
sequence = TTGACTACAAATGTAAACTG

Gene: SSU05_0113: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus thermophilus CNRZ1066

Site:
position = -100
score = 5.33022
sequence = AAATCTATAAATGTAGATAA

Site:
position = -46
score = 5.85756
sequence = AAATCTACAAATGTAAACAA

Gene: str1586: Copper transport transcriptional regulator CopR, CopY family
*
Streptococcus uberis 0140J

Site:
position = -34
score = 6.0991
sequence = ATATTTACAAATGTAAACAA

Site:
position = -66
score = 5.86041
sequence = ATATTTACAATTGTAGATAT

Gene: SUB1464: Copper transport transcriptional regulator CopR, CopY family
Copper transport transcriptional regulator CopR, CopY family
copA
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -54
score = 6.05653
sequence = AAGTTTACAATTGTAAACTA

Gene: LACR_0891: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L45966: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus agalactiae 2603V/R

Gene: SAG0385: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1770: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_0448: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0379: Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0291: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SGO_1934: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus mitis B6

Gene: smi_1432: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus mutans UA159

Gene: SMU.426: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus pneumoniae TIGR4

Gene: SP_0729: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus pyogenes M1 GAS

Gene: SPy1715: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus sanguinis SK36

Gene: SSA_0140: Copper-translocating P-type ATPase (EC 3.6.3.4)
 6
Streptococcus suis 05ZYH33

Gene: SSU05_1386: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SSU05_1385: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SSU05_1384: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SSU05_0220: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SSU05_0221: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SSU05_0222: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus thermophilus CNRZ1066

Gene: str1585: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus uberis 0140J

Gene: SUB1463: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
copZ
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0890: Copper chaperone
 
Lactococcus lactis subsp. lactis Il1403

Gene: L45583: Copper chaperone
 
Streptococcus agalactiae 2603V/R

Gene: SAG0386: Copper chaperone
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1769: Copper chaperone
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0380: Copper chaperone
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1933: Copper chaperone
 
Streptococcus mitis B6
 
Streptococcus mutans UA159

Gene: SMU.427: Copper chaperone
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1714: Copper chaperone
 
Streptococcus sanguinis SK36

Gene: SSA_0141: Copper chaperone
 
Streptococcus suis 05ZYH33

Gene: SSU05_0115: Copper chaperone
 
Streptococcus thermophilus CNRZ1066

Gene: str1584: Copper chaperone
 
Streptococcus uberis 0140J

Gene: SUB1462: Copper chaperone
Copper chaperone
copX
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1768: Truncated copper chaperone
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Truncated copper chaperone
copA2
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0290: Copper-exporting ATPase (EC 3.6.3.4)
 
Streptococcus mitis B6

Gene: smi_1433: Copper-exporting ATPase (EC 3.6.3.4)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_0728: Copper-exporting ATPase (EC 3.6.3.4)
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Copper-exporting ATPase (EC 3.6.3.4)
SSU05_0114
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_0114: Hypothetical protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical protein
 
CRON 3.
ydiD
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -106
score = 5.77652
sequence = ATGTTTACATGTGTAAATTT

Gene: LACR_0427: FMN-dependent NADH-azoreductase
*2
Lactococcus lactis subsp. lactis Il1403

Gene: L115551: FMN-dependent NADH-azoreductase

Site:
position = -106
score = 5.77652
sequence = ATGTTTACATGTGTAAATTT

Gene: L186107: FMN-dependent NADH-azoreductase
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 2
Streptococcus suis 05ZYH33

Gene: SSU05_1570: FMN-dependent NADH-azoreductase

Gene: SSU05_1569: FMN-dependent NADH-azoreductase
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
FMN-dependent NADH-azoreductase
 
CRON 4.
copB
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -65
score = 5.5735
sequence = AGGTTTACAATCGTAAACTT

Gene: LACR_0920: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -62
score = 6.13376
sequence = TAGTTTACAATTGTAAACTA

Gene: L70979: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066

Gene: str0840: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Streptococcus uberis 0140J
Copper-translocating P-type ATPase (EC 3.6.3.4)
 
CRON 5.
yahC
*
Lactococcus lactis subsp. cremoris SK11

Site:
position = -45
score = 5.92409
sequence = TCGTTTACAATTGTAAACAT

Gene: LACR_0072: Hypothetical protein
*
Lactococcus lactis subsp. lactis Il1403

Site:
position = -45
score = 5.92409
sequence = TCGTTTACAATTGTAAACAT

Gene: L200005: Hypothetical protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical protein
yahD
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0073: Copper-inducible alpha/beta serine hydrolase
 
Lactococcus lactis subsp. lactis Il1403

Gene: L79507: Copper-inducible alpha/beta serine hydrolase
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Copper-inducible alpha/beta serine hydrolase
yaiA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0074: Glyoxalase family protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L80191: Glyoxalase family protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Glyoxalase family protein
yaiB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0075: Hypothetical protein
 
Lactococcus lactis subsp. lactis Il1403

Gene: L81206: Hypothetical protein
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD