Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR2 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Idiomarina loihiensis L2TR
Idiomarina baltica OS145
Pseudoalteromonas tunicata D2
Pseudoalteromonas haloplanktis TAC125
Alteromonadales bacterium TW-7
Colwellia psychrerythraea 34H
Glaciecola sp. HTCC2999
Alteromonas macleodii 'Deep ecotype' 8 2
Pseudoalteromonas atlantica T6c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutR2
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -139
score = 5.38566
sequence = AATGGACCTTTTGGTTCAAT

Gene: MADE_00759: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudoalteromonas atlantica T6c
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 2.
rutA
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -182
score = 5.38566
sequence = ATTGAACCAAAAGGTCCATT

Gene: MADE_00760: Pyrimidine oxygenase
 
Pseudoalteromonas atlantica T6c
Pyrimidine oxygenase
rutB
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00761: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Pseudoalteromonas atlantica T6c
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00762: Aminoacrylate peracid reductase
 
Pseudoalteromonas atlantica T6c
Aminoacrylate peracid reductase
rutD
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00763: Aminoacrylate hydrolase
 
Pseudoalteromonas atlantica T6c
Aminoacrylate hydrolase
rutE
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00764: 3-hydroxy propionic acid dehydrogenase
 
Pseudoalteromonas atlantica T6c
3-hydroxy propionic acid dehydrogenase
rutF
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00765: Flavin reductase
 
Pseudoalteromonas atlantica T6c
Flavin reductase
mmsA1
 
Idiomarina loihiensis L2TR
 
Idiomarina baltica OS145
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00766: methylmalonate-semialdehyde dehydrogenase
 
Pseudoalteromonas atlantica T6c
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD