Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR3 - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1 5 2
Pseudomonas entomophila L48 7 4
Pseudomonas fluorescens Pf-5 5 2
Pseudomonas mendocina ymp 6 3
Pseudomonas putida KT2440 6 3
Pseudomonas stutzeri A1501 4 1
Pseudomonas syringae pv. tomato str. DC3000 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pbuT2
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0352: Xanthine/uracil permease
*
Pseudomonas entomophila L48

Site:
position = -127
score = 5.58281
sequence = AATTGACCTAAAAGTCAGCT

Gene: PSEEN2224: Xanthine/uracil permease
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP3992: Xanthine/uracil permease
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Xanthine/uracil permease
 
CRON 2.
tsx
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -71
score = 4.70981
sequence = AGCTGACCCAAAAGACAAGA

Gene: PSEEN1679: Nucleoside-binding outer membrane protein
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas putida KT2440

Site:
position = -74
score = 4.80247
sequence = AGCTGACTCAAAAGACAAAA

Gene: PP4293: Nucleoside-binding outer membrane protein
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Nucleoside-binding outer membrane protein
 
CRON 3.
rutR3
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA1504: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas entomophila L48

Gene: PSEEN1675: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1703: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Pseudomonas mendocina ymp

Site:
position = -119
score = 5.247
sequence = ATTTGACTCAAGAGTCAGAT

Gene: Pmen_2767: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas putida KT2440

Gene: PP4295: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas stutzeri A1501

Gene: PST_3101: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3698: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 4.
xdhA
 
Azotobacter vinelandii AvOP

Gene: Avin_22290: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas aeruginosa PAO1

Site:
position = -139
score = 5.35349
sequence = ATTTGACTCAAAAGTCAGTT

Site:
position = -163
score = 4.14616
sequence = GACTGACCTACAGGTCAAAA

Gene: PA1524: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas entomophila L48

Site:
position = -95
score = 5.941
sequence = TCTTGACCCAAAGGTCAGAA

Site:
position = -72
score = 5.28235
sequence = TATTGACCACAAGGTCAGGC

Gene: PSEEN1765: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas fluorescens Pf-5

Site:
position = -76
score = 5.05284
sequence = CATTGACCGAAAAGTCAGAC

Site:
position = -99
score = 4.69346
sequence = TCCTGACCTTGAAGTCAGAA

Gene: PFL_1889: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas mendocina ymp

Site:
position = -123
score = 5.941
sequence = TGTTGACCCAAAAGTCAGAA

Site:
position = -146
score = 4.56974
sequence = AGCTGACCACAGGGTCAAAT

Gene: Pmen_2751: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas putida KT2440

Site:
position = -93
score = 5.24233
sequence = TCTTGACCCTTGAGTCAGAA

Site:
position = -70
score = 4.73413
sequence = TATTGACCTGCTAGACAGGT

Gene: PP4278: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas stutzeri A1501

Site:
position = -211
score = 5.7942
sequence = AGTTGACCGAAAAGTCAGAT

Site:
position = -234
score = 4.22533
sequence = CATTGACTTTTGAGTCAGGA

Gene: PST_3081: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -72
score = 4.53371
sequence = AATTGACCCAATTGGCAGAG

Site:
position = -95
score = 4.60453
sequence = TCCTGACTTAAGAGTCAGAA

Gene: PSPTO3660: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB
 
Azotobacter vinelandii AvOP

Gene: Avin_22280: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas aeruginosa PAO1

Gene: PA1523: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas entomophila L48

Gene: PSEEN1764: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1888: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas mendocina ymp

Gene: Pmen_2752: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas putida KT2440

Gene: PP4279: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas stutzeri A1501

Gene: PST_3082: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3661: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC
 
Azotobacter vinelandii AvOP

Gene: Avin_22270: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas aeruginosa PAO1

Gene: PA1522: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas entomophila L48

Gene: PSEEN1763: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1887: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas mendocina ymp

Gene: Pmen_2753: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas putida KT2440

Gene: PP4280: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas stutzeri A1501

Gene: PST_3083: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3662: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
guaD
 
Azotobacter vinelandii AvOP

Gene: Avin_22260: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas aeruginosa PAO1

Gene: PA1521: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas entomophila L48

Gene: PSEEN1762: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1886: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas mendocina ymp

Gene: Pmen_2754: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas putida KT2440

Gene: PP4281: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas stutzeri A1501

Gene: PST_3084: Guanine deaminase (EC 3.5.4.3)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3663: Guanine deaminase (EC 3.5.4.3)
Guanine deaminase (EC 3.5.4.3)
 
CRON 5.
pbuT
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -115
score = 5.84685
sequence = TCTTGACCCAGAGGTCAGAA

Gene: PA1519: Xanthine/uracil permease
*
Pseudomonas entomophila L48

Site:
position = -121
score = 4.72878
sequence = TCCTGACCCAGAAGTCAACA

Gene: PSEEN1759: Xanthine/uracil permease
*
Pseudomonas fluorescens Pf-5

Site:
position = -114
score = 5.20596
sequence = TCTTGACCCACAGGTCAACA

Gene: PFL_4364: Xanthine/uracil permease
*
Pseudomonas mendocina ymp

Site:
position = -123
score = 4.50729
sequence = TCTTGACCGCTCGGTCAACA

Gene: Pmen_2756: Xanthine/uracil permease
*
Pseudomonas putida KT2440

Site:
position = -114
score = 5.31244
sequence = TCTTGACCCATAAGTCAACA

Gene: PP4284: Xanthine/uracil permease
 
Pseudomonas stutzeri A1501

Gene: PST_3090: Xanthine/uracil permease
 
Pseudomonas syringae pv. tomato str. DC3000
Xanthine/uracil permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD