Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR2 - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1 7 2
Pseudomonas entomophila L48 5 2
Pseudomonas fluorescens Pf-5 5 2
Pseudomonas mendocina ymp
Pseudomonas putida KT2440 2 1
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pydB
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -99
score = 6.98437
sequence = TCCTGTCAGCGCTGACAGGA

Gene: PA0441: Dihydropyrimidinase (EC 3.5.2.2)
*
Pseudomonas entomophila L48

Site:
position = -100
score = 6.64563
sequence = TCTTGTCAGGCCTGACAGGA

Gene: PSEEN3253: Dihydropyrimidinase (EC 3.5.2.2)
*
Pseudomonas fluorescens Pf-5

Site:
position = -94
score = 6.50884
sequence = TCCTGTCACCGATGACAGGA

Gene: PFL_2548: Dihydropyrimidinase (EC 3.5.2.2)
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Dihydropyrimidinase (EC 3.5.2.2)
pydX
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0440: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Pseudomonas entomophila L48

Gene: PSEEN3252: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2547: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP4037: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
pydA
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0439: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Pseudomonas entomophila L48

Gene: PSEEN3251: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2546: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP4038: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
codB
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0438: Cytosine permease
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4032: Cytosine permease
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP3187: Cytosine permease
 
Pseudomonas stutzeri A1501

Gene: PST_3569: Cytosine permease
 
Pseudomonas syringae pv. tomato str. DC3000
Cytosine permease
codA
 
Azotobacter vinelandii AvOP

Gene: Avin_30170: Cytosine deaminase protein
 
Pseudomonas aeruginosa PAO1

Gene: PA0437: Cytosine deaminase protein
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4033: Cytosine deaminase protein
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP3189: Cytosine deaminase protein
 
Pseudomonas stutzeri A1501

Gene: PST_3570: Cytosine deaminase protein
 
Pseudomonas syringae pv. tomato str. DC3000
Cytosine deaminase protein
 
CRON 2.
pydP
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -273
score = 5.71037
sequence = TCCTGACCGGGGCGACAGGC

Gene: PA0443: Pyrimidine permease in reductive pathway
*
Pseudomonas entomophila L48

Site:
position = -524
score = 6.78076
sequence = TCCTGTCAGGCCTGACAAGA

Gene: PSEEN3254: Pyrimidine permease in reductive pathway
*
Pseudomonas fluorescens Pf-5

Site:
position = -547
score = 6.61161
sequence = TCCTGTCATCGGTGACAGGA

Gene: PFL_2549: Pyrimidine permease in reductive pathway
 
Pseudomonas mendocina ymp
*
Pseudomonas putida KT2440

Site:
position = -266
score = 6.61161
sequence = TCCTGTCAGTCCTGACAAGA

Gene: PP4035: Pyrimidine permease in reductive pathway
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Pyrimidine permease in reductive pathway
pydC
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0444: Beta-ureidopropionase (EC 3.5.1.6)
 
Pseudomonas entomophila L48

Gene: PSEEN3255: Beta-ureidopropionase (EC 3.5.1.6)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2550: Beta-ureidopropionase (EC 3.5.1.6)
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP4034: Beta-ureidopropionase (EC 3.5.1.6)
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Beta-ureidopropionase (EC 3.5.1.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD