Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR4 - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Cellvibrio japonicus Ueda107
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501 7 2
Pseudomonas syringae pv. tomato str. DC3000 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutR4
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
*
Pseudomonas stutzeri A1501

Site:
position = -156
score = 6.03842
sequence = TGTGGACCATTTGGTCCGAA

Gene: PST_3596: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -214
score = 5.79496
sequence = AGCAGACCATTTGGTCTGAA

Gene: PSPTO1158: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 2.
rutA
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
*
Pseudomonas stutzeri A1501

Site:
position = -157
score = 6.03842
sequence = TTCGGACCAAATGGTCCACA

Gene: PST_3597: Pyrimidine oxygenase
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -68
score = 5.79496
sequence = TTCAGACCAAATGGTCTGCT

Gene: PSPTO1157: Pyrimidine oxygenase
Pyrimidine oxygenase
rutB
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3598: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1156: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3599: Aminoacrylate peracid reductase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1155: Aminoacrylate peracid reductase
Aminoacrylate peracid reductase
rutD
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3600: Aminoacrylate hydrolase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1154: Aminoacrylate hydrolase
Aminoacrylate hydrolase
rutE
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3601: 3-hydroxy propionic acid dehydrogenase
 
Pseudomonas syringae pv. tomato str. DC3000
3-hydroxy propionic acid dehydrogenase
rutF
 
Azotobacter vinelandii AvOP
 
Cellvibrio japonicus Ueda107
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3602: Flavin reductase
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1153: Flavin reductase
Flavin reductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD