Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR2 - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acetobacter pasteurianus IFO 3283-01 8 1
Azospirillum sp. B510 8 1
Gluconacetobacter diazotrophicus PAl 5 8 1
Gluconobacter oxydans 621H 6 1
Granulibacter bethesdensis CGDNIH1 8 1
Magnetospirillum magneticum AMB-1
Magnetospirillum magnetotacticum MS-1
Rhodospirillum centenum SW 8 1
Rhodospirillum rubrum ATCC 11170 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR2
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -42
score = 6.22146
sequence = AAACAGGACCGCTCAGGTCTTTAAT

Gene: APA01_16630: Iron-sulfur cluster regulator IscR
*
Azospirillum sp. B510

Site:
position = -54
score = 7.09745
sequence = AATCAGGACTAAATTGGTCCTGTAT

Gene: AZL_c04260: Iron-sulfur cluster regulator IscR
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -77
score = 7.03362
sequence = AATCAGGACTGATTTGGTCCGTTAT

Gene: Gdia_3308: Iron-sulfur cluster regulator IscR
*
Gluconobacter oxydans 621H

Site:
position = -51
score = 6.30655
sequence = AATCAGGACTTAGCAAGTCTTGAAT

Gene: GOX0099: Iron-sulfur cluster regulator IscR
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -27
score = 6.4646
sequence = AAACAGGACTTAATTGGTCCAGTTA

Gene: GbCGDNIH1_1326: Iron-sulfur cluster regulator IscR
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
*
Rhodospirillum centenum SW

Site:
position = -81
score = 5.75879
sequence = AATGTGTACCAGTTTGGTCCGATTT

Gene: RC1_0494: Iron-sulfur cluster regulator IscR
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -45
score = 5.72666
sequence = AAAGAGTACCAATTTAGTCCTGATA

Gene: Rru_A2574: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
sufB
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16620: Iron-sulfur cluster assembly protein SufB
 
Azospirillum sp. B510

Gene: AZL_c04270: Iron-sulfur cluster assembly protein SufB
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3309: Iron-sulfur cluster assembly protein SufB
 
Gluconobacter oxydans 621H

Gene: GOX0098: Iron-sulfur cluster assembly protein SufB
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1325: Iron-sulfur cluster assembly protein SufB
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0493: Iron-sulfur cluster assembly protein SufB
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2573: Iron-sulfur cluster assembly protein SufB
Iron-sulfur cluster assembly protein SufB
sufC
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16610: Iron-sulfur cluster assembly ATPase protein SufC
 
Azospirillum sp. B510

Gene: AZL_c04280: Iron-sulfur cluster assembly ATPase protein SufC
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3310: Iron-sulfur cluster assembly ATPase protein SufC
 
Gluconobacter oxydans 621H

Gene: GOX0097: Iron-sulfur cluster assembly ATPase protein SufC
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1324: Iron-sulfur cluster assembly ATPase protein SufC
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0492: Iron-sulfur cluster assembly ATPase protein SufC
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2572: Iron-sulfur cluster assembly ATPase protein SufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16600: Iron-sulfur (Fe-S) assembly protein SufD
 
Azospirillum sp. B510

Gene: AZL_c04290: Iron-sulfur (Fe-S) assembly protein SufD
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3311: Iron-sulfur (Fe-S) assembly protein SufD
 
Gluconobacter oxydans 621H

Gene: GOX0096: Iron-sulfur (Fe-S) assembly protein SufD
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1323: Iron-sulfur (Fe-S) assembly protein SufD
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0491: Iron-sulfur (Fe-S) assembly protein SufD
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2571: Iron-sulfur (Fe-S) assembly protein SufD
Iron-sulfur (Fe-S) assembly protein SufD
sufS
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16590: cysteine desulfurase SufS
 
Azospirillum sp. B510

Gene: AZL_c04300: cysteine desulfurase SufS
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3312: cysteine desulfurase SufS
 
Gluconobacter oxydans 621H

Gene: GOX0095: cysteine desulfurase SufS
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1322: cysteine desulfurase SufS
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0490: cysteine desulfurase SufS
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2570: cysteine desulfurase SufS
cysteine desulfurase SufS
sufE2
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16580: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Azospirillum sp. B510

Gene: AZL_c04310: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3313: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1321: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0489: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0963: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
sufT
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16570: Iron sulfur cluster assembly protein SufT
 
Azospirillum sp. B510

Gene: AZL_c04320: Iron sulfur cluster assembly protein SufT
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3314: Iron sulfur cluster assembly protein SufT
 
Gluconobacter oxydans 621H

Gene: GOX0094: Iron sulfur cluster assembly protein SufT
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1320: Iron sulfur cluster assembly protein SufT
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0488: Iron sulfur cluster assembly protein SufT
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2569: Iron sulfur cluster assembly protein SufT
Iron sulfur cluster assembly protein SufT
sufA
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_16560: Iron binding protein SufA for iron-sulfur cluster assembly
 
Azospirillum sp. B510

Gene: AZL_c04330: Iron binding protein SufA for iron-sulfur cluster assembly
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_3315: Iron binding protein SufA for iron-sulfur cluster assembly
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_1319: Iron binding protein SufA for iron-sulfur cluster assembly
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_0487: Iron binding protein SufA for iron-sulfur cluster assembly
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2568: Iron binding protein SufA for iron-sulfur cluster assembly
Iron binding protein SufA for iron-sulfur cluster assembly
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD