Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NiaR - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R 1 1
Streptococcus dysgalactiae subsp. equisimilis GGS_124 2 2
Streptococcus equi subsp. zooepidemicus MGCS10565 2 2
Streptococcus gallolyticus UCN34 4 3
Streptococcus gordonii str. Challis substr. CH1 1 1
Streptococcus mitis B6 1 1
Streptococcus mutans UA159 2 2
Streptococcus pneumoniae TIGR4 3 3
Streptococcus pyogenes M1 GAS 3 3
Streptococcus sanguinis SK36 1 1
Streptococcus suis 05ZYH33 1 1
Streptococcus thermophilus CNRZ1066 1 1
Streptococcus uberis 0140J 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pnuC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
*
Streptococcus mutans UA159

Site:
position = -74
score = 4.97617
sequence = aAtataTGTCTTgACACaTGTA

Gene: SMU.946: Ribosyl nicotinamide transporter, PnuC-like
*
Streptococcus pneumoniae TIGR4

Site:
position = -188
score = 4.51005
sequence = TTTTACTGTAAAGACAGTTGAC

Gene: SP_1859: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36

Gene: SSA_1316: Ribosyl nicotinamide transporter, PnuC-like
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Ribosyl nicotinamide transporter, PnuC-like
 
CRON 2.
pncA
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_0273: Nicotinamidase (EC 3.5.1.19)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L67226: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus agalactiae 2603V/R

Gene: SAG1674: Nicotinamidase (EC 3.5.1.19)
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -88
score = 4.81667
sequence = GTTAGTTGTCTTGACACCTGTA

Gene: SDEG_1847: Nicotinamidase (EC 3.5.1.19)
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -139
score = 5.05825
sequence = ATCTACTGTCTTGACAGCTGTC

Gene: Sez_0388: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1875: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0432: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus mitis B6

Gene: smi_0688: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus mutans UA159

Gene: SMU.1823: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus pneumoniae TIGR4

Gene: SP_1583: Nicotinamidase (EC 3.5.1.19)
*
Streptococcus pyogenes M1 GAS

Site:
position = -88
score = 4.6712
sequence = AATAGATGTCTTGATACCTGTA

Gene: SPy1776: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus sanguinis SK36

Gene: SSA_0567: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus suis 05ZYH33

Gene: SSU05_0351: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus thermophilus CNRZ1066

Gene: str1634: Nicotinamidase (EC 3.5.1.19)
 
Streptococcus uberis 0140J

Gene: SUB1527: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
 
CRON 3.
nadA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -80
score = 5.58542
sequence = TACAGGTGTCTTGACACCTGGC

Gene: GALLO_1937: Quinolinate synthetase A
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Quinolinate synthetase A
 
CRON 4.
nadB
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -177
score = 4.65521
sequence = GCCAGGTGTCAAGACACCTGTA

Gene: GALLO_1936: L-aspartate oxidase
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
L-aspartate oxidase
nadC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_1935: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
*
Streptococcus pneumoniae TIGR4

Site:
position = -134
score = 5.95985
sequence = TACAATTGTCTTGACAATTGTC

Site:
position = -122
score = 5.65993
sequence = GACAATTGTCTTGACACTTGTT

Gene: SP_2016: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
*
Streptococcus pyogenes M1 GAS

Site:
position = -122
score = 6.18288
sequence = TACAATTGTCTTGACACTTGTT

Gene: SPy0197: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
CRON 5.
niaX
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1282: Substrate-specific component NiaX of predicted niacin ECF transporter
 
Lactococcus lactis subsp. lactis Il1403

Gene: L173230: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus agalactiae 2603V/R

Site:
position = -58
score = 6.37155
sequence = TACAGGTGTCTTTACACCTGTA

Gene: SAG1602: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -59
score = 6.14424
sequence = TATAGGTGTCTTGACACTTGTA

Gene: SDEG_1467: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -62
score = 4.21863
sequence = GCTAGGTGTCTTGACATCTGTC

Gene: Sez_0638: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus gallolyticus UCN34

Site:
position = -191
score = 5.83711
sequence = TACAGGTGTCTTGACACCTGTG

Gene: GALLO_0647: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus gordonii str. Challis substr. CH1

Site:
position = -32
score = 6.20346
sequence = TACTACTGTATATACACATAAA

Gene: SGO_1046: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus mitis B6

Site:
position = -33
score = 6.51414
sequence = TACTAGTGTATATACAGTTAAA

Gene: smi_1196: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus mutans UA159

Site:
position = -67
score = 6.29071
sequence = AACTAGTGTCTTGACAGATGTA

Gene: SMU.332: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus pneumoniae TIGR4

Site:
position = 20
score = 6.18018
sequence = TACTAGTGTATATGCAGTTAAA

Gene: SP_1233: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus pyogenes M1 GAS

Site:
position = -59
score = 5.5942
sequence = TACAGGTGTCTTGATAGTTATT

Gene: SPy1425: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus sanguinis SK36

Site:
position = -33
score = 6.47971
sequence = TACTAGTGTATATACAGATAAA

Gene: SSA_1348: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus suis 05ZYH33

Site:
position = -173
score = 5.80434
sequence = TACAGGCGTCTTGACACCTGTA

Gene: SSU05_2019: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus thermophilus CNRZ1066

Site:
position = 28
score = 6.10262
sequence = TACTATTGTATTTACAGAAAAA

Gene: str0890: Substrate-specific component NiaX of predicted niacin ECF transporter
*
Streptococcus uberis 0140J

Site:
position = -58
score = 6.34289
sequence = TACAGGTGTCTTGACACCTGTA

Gene: SUB1261: Substrate-specific component NiaX of predicted niacin ECF transporter
Substrate-specific component NiaX of predicted niacin ECF transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD