Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DvMF_1994 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Carbohydrate metabolism
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 2 1
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F 5 3
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DvMF_1994
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -65
score = 5.43609
sequence = ATCTTATATTTTTTGCAAGAC

Gene: DvMF_1994: transcriptional regulator, GntR family
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, GntR family
 
CRON 2.
DvMF_2004
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2325: D-galactarate dehydratase/altronate hydrolase-like protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2155: D-galactarate dehydratase/altronate hydrolase-like protein
 
Desulfovibrio desulfuricans G20
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -136
score = 4.68536
sequence = GTCTTATACCTGATGCAATAT

Gene: Ddes_2374: D-galactarate dehydratase/altronate hydrolase-like protein
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
*2
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -57
score = 6.27661
sequence = GTCTTGCATAAGACATCATAC

Gene: DvMF_2006: D-galactarate dehydratase/altronate hydrolase-like protein

Site:
position = -56
score = 6.27661
sequence = GTCTTGCATAAGACATCATAC

Gene: DvMF_2004: D-galactarate dehydratase/altronate hydrolase-like protein
 
Lawsonia intracellularis PHE/MN1-00
D-galactarate dehydratase/altronate hydrolase-like protein
DvMF_2005
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2324: Altronate hydrolase (EC 4.2.1.7)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2156: Altronate hydrolase (EC 4.2.1.7)
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2375: Altronate hydrolase (EC 4.2.1.7)
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 2
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2003: Altronate hydrolase (EC 4.2.1.7)

Gene: DvMF_2005: Altronate hydrolase (EC 4.2.1.7)
 
Lawsonia intracellularis PHE/MN1-00
Altronate hydrolase (EC 4.2.1.7)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD