Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 8 5
Chloroflexus sp. Y-400-fl 3 1
Roseiflexus castenholzii DSM 13941 4 2
Herpetosiphon aurantiacus ATCC 23779 11 8
Roseiflexus sp. RS-1 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Haur_1311
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -47
score = 5.94691
sequence = TATTGATATAATATATCAGTA

Gene: Haur_1311: Acetyltransferase
 
Roseiflexus sp. RS-1
Acetyltransferase
 
CRON 2.
Haur_3793
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -34
score = 6.13962
sequence = TATTGATATCAAGTATCAATA

Gene: Haur_3793: Thioredoxin reductase (EC 1.8.1.9)
 
Roseiflexus sp. RS-1
Thioredoxin reductase (EC 1.8.1.9)
 
CRON 3.
Haur_2300
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -80
score = 6.49117
sequence = TAATGATACTTTGTATCAATA

Gene: Haur_2300: cold-shock DNA-binding domain protein
 
Roseiflexus sp. RS-1
cold-shock DNA-binding domain protein
 
CRON 4.
Rcas_3893
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3893: hypothetical protein
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -20
score = 6.34355
sequence = TAATGATATATAGTATCAATA

Site:
position = -82
score = 6.49777
sequence = TAATGATACATTATATCAATA

Gene: Haur_4472: hypothetical protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_0845: hypothetical protein
hypothetical protein
 
CRON 5.
yciC3
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -54
score = 6.59304
sequence = TATTGATATATTGTATCAATA

Gene: Haur_2062: Putative metal chaperone involved in Zn homeostasis, COG0523 family
 
Roseiflexus sp. RS-1
Putative metal chaperone involved in Zn homeostasis, COG0523 family
 
CRON 6.
znuA
*
Chloroflexus aggregans DSM 9485

Site:
position = -35
score = 5.92053
sequence = AATTGAAACATAGTTTCATTA

Gene: Cagg_2043: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Chloroflexus sp. Y-400-fl

Site:
position = -35
score = 6.07475
sequence = TTTTGAAACAATGTTTCATTA

Gene: Chy400_2148: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Roseiflexus castenholzii DSM 13941

Site:
position = -122
score = 5.34844
sequence = TATCCATACCACATATCAATA

Gene: Rcas_1591: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -95
score = 6.24827
sequence = TAATGATACAAAATATCATTA

Gene: Haur_2064: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Roseiflexus sp. RS-1

Site:
position = -124
score = 5.54577
sequence = TATAAAAACGAAGTATCAATA

Gene: RoseRS_1258: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2044: Zinc ABC transporter, ATP-binding protein ZnuC
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2149: Zinc ABC transporter, ATP-binding protein ZnuC
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1590: Zinc ABC transporter, ATP-binding protein ZnuC
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2065: Zinc ABC transporter, ATP-binding protein ZnuC
 
Roseiflexus sp. RS-1

Gene: RoseRS_1257: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2045: Zinc ABC transporter, permease protein ZnuB
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2150: Zinc ABC transporter, permease protein ZnuB
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1589: Zinc ABC transporter, permease protein ZnuB
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2066: Zinc ABC transporter, permease protein ZnuB
 
Roseiflexus sp. RS-1

Gene: RoseRS_1256: Zinc ABC transporter, permease protein ZnuB
Zinc ABC transporter, permease protein ZnuB
 
CRON 7.
COG0701
*
Chloroflexus aggregans DSM 9485

Site:
position = -74
score = 5.7849
sequence = TATTGACACACTGTATCAATA

Gene: Cagg_2028: predicted permease
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3894: predicted permease
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1

Gene: RoseRS_0592: predicted permease
predicted permease
 
CRON 8.
yciC
*
Chloroflexus aggregans DSM 9485

Site:
position = -79
score = 5.81023
sequence = TAATGATATAACGTATCATTT

Site:
position = -20
score = 4.48867
sequence = AATCGAGATAAGGTATCAATG

Gene: Cagg_0608: Putative metal chaperone involved in Zn homeostasis, COG0523 family
 
Chloroflexus sp. Y-400-fl
*
Roseiflexus castenholzii DSM 13941

Site:
position = -58
score = 4.25038
sequence = CATTGATATACACTATCATCA

Gene: Rcas_2945: Putative metal chaperone involved in Zn homeostasis, COG0523 family
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -42
score = 6.34355
sequence = TAATGATATATAGTATCAATA

Gene: Haur_0639: Putative metal chaperone involved in Zn homeostasis, COG0523 family
 
Roseiflexus sp. RS-1

Gene: RoseRS_3105: Putative metal chaperone involved in Zn homeostasis, COG0523 family
Putative metal chaperone involved in Zn homeostasis, COG0523 family
 
CRON 9.
fmdB
*
Chloroflexus aggregans DSM 9485

Site:
position = -52
score = 5.47155
sequence = AAATGATATATTATCTCAATA

Gene: Cagg_0322: putative regulatory protein, FmdB family
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2948: putative regulatory protein, FmdB family
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2075: putative regulatory protein, FmdB family
 
Roseiflexus sp. RS-1

Gene: RoseRS_3107: putative regulatory protein, FmdB family
putative regulatory protein, FmdB family
yciC2
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2949: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*2
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4200: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Site:
position = -286
score = 6.49777
sequence = TAATGATATATTGTATCAATA

Gene: Haur_2074: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Roseiflexus sp. RS-1

Gene: RoseRS_3108: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
zur
*2
Chloroflexus aggregans DSM 9485

Site:
position = -2
score = 5.82342
sequence = TAATGATCCATAGTATCATTA

Gene: Cagg_2024: Zinc homeostasis transcriptional regulator Zur, Fur family

Gene: Cagg_1460: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1857: Zinc homeostasis transcriptional regulator Zur, Fur family
 2
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3901: Zinc homeostasis transcriptional regulator Zur, Fur family

Gene: Rcas_1649: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2073: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Roseiflexus sp. RS-1

Gene: RoseRS_1293: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD