Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FetR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Roseiflexus sp. RS-1 17 3
Roseiflexus castenholzii DSM 13941 17 3
Herpetosiphon aurantiacus ATCC 23779
Chloroflexus sp. Y-400-fl 16 5
Chloroflexus aggregans DSM 9485 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fbpA
*
Roseiflexus sp. RS-1

Site:
position = -157
score = 5.9934
sequence = ATGTTAGAGTAATCTAACAA

Gene: RoseRS_2294: Ferric iron ABC transporter, periplasmic-binding protein
*
Roseiflexus castenholzii DSM 13941

Site:
position = -159
score = 5.50246
sequence = ATGTTAGAGTAACCTAACAC

Gene: Rcas_3171: Ferric iron ABC transporter, periplasmic-binding protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1722: Ferric iron ABC transporter, periplasmic-binding protein
*
Chloroflexus sp. Y-400-fl

Site:
position = -55
score = 6.20265
sequence = TTATTAGTGTATACTAATAA

Gene: Chy400_0349: Ferric iron ABC transporter, periplasmic-binding protein
*
Chloroflexus aggregans DSM 9485

Site:
position = -83
score = 5.56503
sequence = ACGTTAGCATATACTAACCC

Gene: Cagg_2416: Ferric iron ABC transporter, periplasmic-binding protein
Ferric iron ABC transporter, periplasmic-binding protein
fbpB
 
Roseiflexus sp. RS-1

Gene: RoseRS_2293: Ferric iron ABC transporter, permease protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3172: Ferric iron ABC transporter, permease protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1721: Ferric iron ABC transporter, permease protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0348: Ferric iron ABC transporter, permease protein
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2417: Ferric iron ABC transporter, permease protein
Ferric iron ABC transporter, permease protein
fbpC
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_1720: Ferric iron ABC transporter, ATP-binding protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0347: Ferric iron ABC transporter, ATP-binding protein
 
Chloroflexus aggregans DSM 9485
Ferric iron ABC transporter, ATP-binding protein
 
CRON 2.
Haur_0321
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0321: hypothetical transporter, MFS superfamily
*
Chloroflexus sp. Y-400-fl

Site:
position = -136
score = 5.79717
sequence = TAATTAGCATACACTAACTA

Gene: Chy400_4135: hypothetical transporter, MFS superfamily
 
Chloroflexus aggregans DSM 9485
hypothetical transporter, MFS superfamily
fepB
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_4136: Iron siderophore ABC transporter, periplasmic component
 
Chloroflexus aggregans DSM 9485
Iron siderophore ABC transporter, periplasmic component
 
CRON 3.
COG0716
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
*
Chloroflexus sp. Y-400-fl

Site:
position = -158
score = 6.18424
sequence = TTATTAGCATATACTAACCT

Gene: Chy400_0344: flavodoxin
 
Chloroflexus aggregans DSM 9485
flavodoxin
Chy400_0343
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0343: hypothetical protein
 
Chloroflexus aggregans DSM 9485
hypothetical protein
fepB2
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0342: Iron siderophore ABC transporter, periplasmic component
 
Chloroflexus aggregans DSM 9485
Iron siderophore ABC transporter, periplasmic component
Chy400_0341
 
Roseiflexus sp. RS-1
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0341: hypothetical protein
 
Chloroflexus aggregans DSM 9485
hypothetical protein
 
CRON 4.
RoseRS_4469
*
Roseiflexus sp. RS-1

Site:
position = -141
score = 6.03066
sequence = TTATTAGGATATGCTAACCA

Gene: RoseRS_4469: hypothetical protein
*
Roseiflexus castenholzii DSM 13941

Site:
position = -98
score = 6.32925
sequence = TTATTAGCATATGCTAACAT

Gene: Rcas_0821: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0469: hypothetical protein
*
Chloroflexus sp. Y-400-fl

Site:
position = -92
score = 5.81524
sequence = TTATTAGAGTATGCTAACCG

Gene: Chy400_0685: hypothetical protein
 
Chloroflexus aggregans DSM 9485
hypothetical protein
ftr
 
Roseiflexus sp. RS-1

Gene: RoseRS_4468: High-affinity Fe2+ permease, FTR family
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0820: High-affinity Fe2+ permease, FTR family
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0468: High-affinity Fe2+ permease, FTR family
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0686: High-affinity Fe2+ permease, FTR family
 
Chloroflexus aggregans DSM 9485
High-affinity Fe2+ permease, FTR family
RoseRS_4467
 
Roseiflexus sp. RS-1

Gene: RoseRS_4467: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0819: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
RoseRS_4466
 
Roseiflexus sp. RS-1

Gene: RoseRS_4466: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0818: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
 
CRON 5.
hmuV
*
Roseiflexus sp. RS-1

Site:
position = -109
score = 5.96912
sequence = TTATTAGACTATACTAACCA

Gene: RoseRS_3564: Heme ABC transporter, ATPase component HmuV
*
Roseiflexus castenholzii DSM 13941

Site:
position = -123
score = 5.90096
sequence = TTATTAGACTATACTAACTT

Gene: Rcas_4373: Heme ABC transporter, ATPase component HmuV
 
Herpetosiphon aurantiacus ATCC 23779
*
Chloroflexus sp. Y-400-fl

Site:
position = -57
score = 5.78509
sequence = AAATTAGAGTATTCTAATAG

Gene: Chy400_2616: Heme ABC transporter, ATPase component HmuV
*
Chloroflexus aggregans DSM 9485

Site:
position = -57
score = 5.97798
sequence = AAATTAGTATATTCTAACTT

Gene: Cagg_3308: Heme ABC transporter, ATPase component HmuV
Heme ABC transporter, ATPase component HmuV
hmuT
 
Roseiflexus sp. RS-1

Gene: RoseRS_3565: Heme ABC transporter, hemin-binding periplasmic component hmuT
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4372: Heme ABC transporter, hemin-binding periplasmic component hmuT
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2617: Heme ABC transporter, hemin-binding periplasmic component hmuT
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3307: Heme ABC transporter, hemin-binding periplasmic component hmuT
Heme ABC transporter, hemin-binding periplasmic component hmuT
hmuU
 
Roseiflexus sp. RS-1

Gene: RoseRS_3566: Heme ABC transporter, permease component HmuU
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4371: Heme ABC transporter, permease component HmuU
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2618: Heme ABC transporter, permease component HmuU
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3306: Heme ABC transporter, permease component HmuU
Heme ABC transporter, permease component HmuU
RoseRS_3567
 
Roseiflexus sp. RS-1

Gene: RoseRS_3567: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4370: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
RoseRS_0755
 
Roseiflexus sp. RS-1

Gene: RoseRS_3568: Hypothetical similar to CcmC, putative heme lyase for CcmE
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4369: Hypothetical similar to CcmC, putative heme lyase for CcmE
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
Hypothetical similar to CcmC, putative heme lyase for CcmE
RoseRS_3569
 
Roseiflexus sp. RS-1

Gene: RoseRS_3569: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4368: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
COG2329
 
Roseiflexus sp. RS-1

Gene: RoseRS_3570: hypothetical monooxygenase
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4367: hypothetical monooxygenase
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2619: hypothetical monooxygenase
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3305: hypothetical monooxygenase
hypothetical monooxygenase
RoseRS_3571
 
Roseiflexus sp. RS-1

Gene: RoseRS_3571: Hemin ABC transporter, permease protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4366: Hemin ABC transporter, permease protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
Hemin ABC transporter, permease protein
RoseRS_3572
 
Roseiflexus sp. RS-1

Gene: RoseRS_3572: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4365: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
RoseRS_3573
 
Roseiflexus sp. RS-1

Gene: RoseRS_3573: hypothetical protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4364: hypothetical protein
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl
 
Chloroflexus aggregans DSM 9485
hypothetical protein
fetR
 
Roseiflexus sp. RS-1

Gene: RoseRS_3574: Ferrous iron dependent repressor, DtxR family
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4363: Ferrous iron dependent repressor, DtxR family
 
Herpetosiphon aurantiacus ATCC 23779
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2620: Ferrous iron dependent repressor, DtxR family
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3304: Ferrous iron dependent repressor, DtxR family
Ferrous iron dependent repressor, DtxR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD