Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 5 2
Chloroflexus sp. Y-400-fl 4 1
Roseiflexus castenholzii DSM 13941 5 2
Herpetosiphon aurantiacus ATCC 23779 4 1
Roseiflexus sp. RS-1 8 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntR
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1173: Mn-dependent transcriptional regulator MntR, DtxR family
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0107: Mn-dependent transcriptional regulator MntR, DtxR family
*
Roseiflexus castenholzii DSM 13941

Site:
position = -9
score = 5.84772
sequence = GTTTTAGGAATGCCTAAATA

Gene: Rcas_3322: Mn-dependent transcriptional regulator MntR, DtxR family
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4031: Mn-dependent transcriptional regulator MntR, DtxR family
*
Roseiflexus sp. RS-1

Site:
position = -29
score = 5.49011
sequence = GTTTTAGGTCTACCTAAATT

Gene: RoseRS_3986: Mn-dependent transcriptional regulator MntR, DtxR family
Mn-dependent transcriptional regulator MntR, DtxR family
 
CRON 2.
mntH
*
Chloroflexus aggregans DSM 9485

Site:
position = -74
score = 5.57948
sequence = AATTTAGGGAATACTAAAAA

Gene: Cagg_1154: Manganese transport protein MntH, NRAMP family
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1
Manganese transport protein MntH, NRAMP family
 
CRON 3.
mntA
*
Chloroflexus aggregans DSM 9485

Site:
position = -38
score = 6.03137
sequence = ATTTTAGGTTAGGCTAAAAT

Gene: Cagg_3553: Manganese ABC transporter, periplasmic-binding protein
*
Chloroflexus sp. Y-400-fl

Site:
position = -40
score = 5.82405
sequence = GATTTAGGTAAGGCTAAAAT

Gene: Chy400_0210: Manganese ABC transporter, periplasmic-binding protein
*
Roseiflexus castenholzii DSM 13941

Site:
position = -55
score = 5.90607
sequence = ATTTTAGGATTTCCAAAATT

Gene: Rcas_1724: Manganese ABC transporter, periplasmic-binding protein
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -51
score = 5.75184
sequence = CTTTTAGGTATGCCTAAATA

Gene: Haur_4030: Manganese ABC transporter, periplasmic-binding protein
*
Roseiflexus sp. RS-1

Site:
position = -42
score = 5.63839
sequence = GATTTAGGCAAGACAAAATT

Gene: RoseRS_3070: Manganese ABC transporter, periplasmic-binding protein
Manganese ABC transporter, periplasmic-binding protein
mntB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3554: Manganese ABC transporter, ATP-binding protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0209: Manganese ABC transporter, ATP-binding protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1723: Manganese ABC transporter, ATP-binding protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4029: Manganese ABC transporter, ATP-binding protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_3069: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mntC
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3555: Manganese ABC transporter, inner membrane permease protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0208: Manganese ABC transporter, inner membrane permease protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1722: Manganese ABC transporter, inner membrane permease protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4028: Manganese ABC transporter, inner membrane permease protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_3068: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
mntD
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3556: Manganese ABC transporter, inner membrane permease protein
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0207: Manganese ABC transporter, inner membrane permease protein
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1721: Manganese ABC transporter, inner membrane permease protein
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4027: Manganese ABC transporter, inner membrane permease protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_3067: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
 
CRON 4.
MntR2
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus sp. RS-1

Site:
position = -85
score = 6.26236
sequence = ATTTTAGGAATGCCTAAATT

Gene: RoseRS_4512: Mn-dependent transcriptional regulator MntR, DtxR family
Mn-dependent transcriptional regulator MntR, DtxR family
feoB1
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1

Gene: RoseRS_4511: Ferrous iron transport protein B
Ferrous iron transport protein B
feoB2
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Roseiflexus castenholzii DSM 13941
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus sp. RS-1

Gene: RoseRS_4510: Ferrous iron transport protein B
Ferrous iron transport protein B
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD