Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 5 1
Chloroflexus sp. Y-400-fl 6 2
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941 1 1
Roseiflexus sp. RS-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Cagg_1452
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1452: oxidoreductase molybdopterin binding
*
Chloroflexus sp. Y-400-fl

Site:
position = -166
score = 6.87022
sequence = AGTATTCACAATGTGAATACT

Gene: Chy400_2684: oxidoreductase molybdopterin binding
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
oxidoreductase molybdopterin binding
 
CRON 2.
modR
*
Chloroflexus aggregans DSM 9485

Site:
position = -82
score = 6.10895
sequence = AGTACTCACATCGTGAATATA

Gene: Cagg_1371: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
*
Chloroflexus sp. Y-400-fl

Site:
position = -102
score = 6.87022
sequence = AGTATTCACATTGTGAATACT

Gene: Chy400_2685: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -27
score = 5.31354
sequence = TATATTTATTTTTTGAATAGT

Gene: Rcas_2179: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
 
Roseiflexus sp. RS-1
Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
modA
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1370: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2686: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2178: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1798: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
modB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1369: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2687: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2177: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1797: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1368: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_2176: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1796: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Cagg_1367
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1367: Metal-dependent hydrolase
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2689: Metal-dependent hydrolase
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0130: Metal-dependent hydrolase
 
Roseiflexus sp. RS-1

Gene: RoseRS_4339: Metal-dependent hydrolase
Metal-dependent hydrolase
Chy400_2688
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2688: ABC transporter related
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
ABC transporter related
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD