Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 6 2
Chloroflexus sp. Y-400-fl 6 2
Roseiflexus castenholzii DSM 13941 6 2
Herpetosiphon aurantiacus ATCC 23779 6 2
Roseiflexus sp. RS-1 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
*
Chloroflexus aggregans DSM 9485

Site:
position = -55
score = 7.59523
sequence = TTAGCACTCTCGCCTCACGAGTGCTAA

Gene: Cagg_2696: Heat-inducible transcription repressor HrcA
*
Chloroflexus sp. Y-400-fl

Site:
position = -55
score = 7.43587
sequence = TTAGCACTCTCACCTCACGAGTGCTAA

Gene: Chy400_2238: Heat-inducible transcription repressor HrcA
*
Roseiflexus castenholzii DSM 13941

Site:
position = -102
score = 7.22691
sequence = CTAGCACTCACCGGTCGAGAGTGCTAA

Gene: Rcas_4390: Heat-inducible transcription repressor HrcA
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -40
score = 7.325
sequence = TTAGCACTCCTCGGCCAAGAGTGCTAA

Gene: Haur_0438: Heat-inducible transcription repressor HrcA
*
Roseiflexus sp. RS-1

Site:
position = -190
score = 7.07536
sequence = CTAGCACTCAATAGTCGAGAGTGCTAA

Gene: RoseRS_3462: Heat-inducible transcription repressor HrcA
Heat-inducible transcription repressor HrcA
grpE
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2695: Heat shock protein GrpE
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2237: Heat shock protein GrpE
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4391: Heat shock protein GrpE
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0439: Heat shock protein GrpE
 
Roseiflexus sp. RS-1

Gene: RoseRS_3461: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2694: Chaperone protein DnaK
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2236: Chaperone protein DnaK
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4392: Chaperone protein DnaK
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0440: Chaperone protein DnaK
 
Roseiflexus sp. RS-1

Gene: RoseRS_3460: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2693: Chaperone protein DnaJ
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2235: Chaperone protein DnaJ
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_4393: Chaperone protein DnaJ
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_0441: Chaperone protein DnaJ
 
Roseiflexus sp. RS-1

Gene: RoseRS_3459: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 2.
groES
*
Chloroflexus aggregans DSM 9485

Site:
position = -81
score = 7.56762
sequence = TTAGCACTCTTGAGTTAACAGTGCTAA

Site:
position = -154
score = 6.00135
sequence = TTAGCACTCAGTTTCGACGAGTGCTAA

Gene: Cagg_0489: Heat shock protein 60 family co-chaperone GroES
*
Chloroflexus sp. Y-400-fl

Site:
position = -83
score = 7.36886
sequence = TTAGCACTCTCGACGTGACAGTGCTAA

Site:
position = -156
score = 6.01522
sequence = CTAGCAATCTCTAACGTCGAGTGCTAA

Gene: Chy400_2961: Heat shock protein 60 family co-chaperone GroES
*
Roseiflexus castenholzii DSM 13941

Site:
position = -72
score = 7.67377
sequence = TTAGCACTCTTTGGTCAAGAGTGCTAA

Site:
position = -145
score = 6.35457
sequence = CTGGCACTCTCATCTGGCGAGTGCTAA

Gene: Rcas_1212: Heat shock protein 60 family co-chaperone GroES
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -54
score = 6.75625
sequence = TTAGCACTCATCACAGTAGATTGCTAA

Site:
position = -129
score = 7.17832
sequence = TTAGCACTCTCAACCCAAGAGTGATAA

Site:
position = -231
score = 6.15139
sequence = TTAGCACTCTCGCCACGATTTTGCTAA

Gene: Haur_3678: Heat shock protein 60 family co-chaperone GroES
*
Roseiflexus sp. RS-1

Site:
position = -75
score = 7.75523
sequence = TTAGCACTCTTCCGTCGAGAGTGCTAA

Site:
position = -148
score = 6.41072
sequence = CTGGCACTCTTCCCTTTTGAGTGCTAA

Gene: RoseRS_4130: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groEL
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_0488: Heat shock protein 60 family chaperone GroEL
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_2960: Heat shock protein 60 family chaperone GroEL
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1211: Heat shock protein 60 family chaperone GroEL
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_3679: Heat shock protein 60 family chaperone GroEL
 
Roseiflexus sp. RS-1

Gene: RoseRS_4131: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD