Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Dbac_0104 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process: Metabolite transport
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028 4 2
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1 5 2
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 4 1
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DMR_28390
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -26
score = 5.3006
sequence = TTGTGAACCGGTGTTAACTT

Gene: DMR_28390: TetR family transcriptional regulator
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
TetR family transcriptional regulator
 
CRON 2.
Dbac_0104
 
Desulfohalobium retbaense DSM 5692
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -28
score = 5.87366
sequence = AAGTGAACGATCGTTAACTA

Gene: Dbac_0104: transcriptional regulator, TetR family
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, TetR family
 
CRON 3.
DMR_28400
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = 32
score = 5.68759
sequence = AAGTGAACACGCGTTAACGC

Gene: DMR_28400: hypothetical protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
acrA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0307: efflux transporter, RND family, MFP subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_28410: efflux transporter, RND family, MFP subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02842: efflux transporter, RND family, MFP subunit
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0060: efflux transporter, RND family, MFP subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2164: efflux transporter, RND family, MFP subunit
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0993: efflux transporter, RND family, MFP subunit
efflux transporter, RND family, MFP subunit
acrB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0308: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio magneticus RS-1

Gene: DMR_28420: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02843: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0061: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2163: RND efflux system, inner membrane transporter CmeB
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0994: RND efflux system, inner membrane transporter CmeB
RND efflux system, inner membrane transporter CmeB
DMR_28430
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_28430: Transcriptional regulator, MarR family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2161: Transcriptional regulator, MarR family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, MarR family
 
CRON 4.
acrA
 
Desulfohalobium retbaense DSM 5692
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -54
score = 6.09597
sequence = AAGTGAACACTTGTTCACAT

Gene: Dbac_0103: efflux transporter, RND family, MFP subunit
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2817: efflux transporter, RND family, MFP subunit
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
efflux transporter, RND family, MFP subunit
DVU2816
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0102: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2816: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
RND efflux system, inner membrane transporter CmeB
Dbac_0101
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0101: RND efflux system, outer membrane lipoprotein, NodT family
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2815: RND efflux system, outer membrane lipoprotein, NodT family
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
RND efflux system, outer membrane lipoprotein, NodT family
 
CRON 5.
Desal_2340
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -42
score = 5.32107
sequence = AAGTTAAAGTGAATTCACAT

Site:
position = -36
score = 5.54038
sequence = AAGTGAATTCACATTCACAT

Gene: Desal_2340: transcriptional regulator, TetR family
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, TetR family
Desal_2341
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0700: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1342: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
 
Desulfovibrio magneticus RS-1

Gene: DMR_22940: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2341: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
Desal_2342
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0699: ABC transporter ATP-binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1341: ABC transporter ATP-binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_22930: ABC transporter ATP-binding protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2342: ABC transporter ATP-binding protein
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ABC transporter ATP-binding protein
Desal_2343
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0698: ABC-type multidrug transport system, permease component
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1340: ABC-type multidrug transport system, permease component
 
Desulfovibrio magneticus RS-1

Gene: DMR_22920: ABC-type multidrug transport system, permease component
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2343: ABC-type multidrug transport system, permease component
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD