Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DVU0057 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 3 1
Desulfovibrio vulgaris Hildenborough 7 1
Desulfovibrio vulgaris str. Miyazaki F 5 1
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DVU0057
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_34120: Transcriptional regulator, TetR family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -31
score = 6.70386
sequence = GTTTCAAACAAGGGTTGAAAC

Gene: DVU0057: Transcriptional regulator, TetR family
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -70
score = 6.96413
sequence = GGTTCAAACAATGATTGAATT

Gene: DvMF_2165: Transcriptional regulator, TetR family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, TetR family
DVU0058
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0058: efflux transporter, RND family, MFP subunit
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
efflux transporter, RND family, MFP subunit
DVU0059
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0059: AcrB/AcrD/AcrF family protein
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
AcrB/AcrD/AcrF family protein
acrA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0307: efflux transporter, RND family, MFP subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_28410: efflux transporter, RND family, MFP subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02842: efflux transporter, RND family, MFP subunit
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0060: efflux transporter, RND family, MFP subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2164: efflux transporter, RND family, MFP subunit
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0993: efflux transporter, RND family, MFP subunit
efflux transporter, RND family, MFP subunit
acrB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0308: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio magneticus RS-1

Gene: DMR_28420: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02843: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0061: RND efflux system, inner membrane transporter CmeB
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2163: RND efflux system, inner membrane transporter CmeB
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0994: RND efflux system, inner membrane transporter CmeB
RND efflux system, inner membrane transporter CmeB
oprM
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0309: RND efflux system, outer membrane lipoprotein, NodT family
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02844: RND efflux system, outer membrane lipoprotein, NodT family
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0062: RND efflux system, outer membrane lipoprotein, NodT family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2162: RND efflux system, outer membrane lipoprotein, NodT family
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0995: RND efflux system, outer membrane lipoprotein, NodT family
RND efflux system, outer membrane lipoprotein, NodT family
DVU0063
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0063: Transcriptional regulator, MarR family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1558: Transcriptional regulator, MarR family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, MarR family
DMR_28430
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_28430: Transcriptional regulator, MarR family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2161: Transcriptional regulator, MarR family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, MarR family
 
CRON 2.
Desal_0950
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -37
score = 6.70386
sequence = GCTTCAAACAGTGTTTTAATT

Gene: Desal_0950: transcriptional regulator, TetR family
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
transcriptional regulator, TetR family
Dbac_1783
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1783: efflux transporter, RND family, MFP subunit
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0949: efflux transporter, RND family, MFP subunit
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
efflux transporter, RND family, MFP subunit
Dbac_1782
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1782: acriflavin resistance protein
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0948: acriflavin resistance protein
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
acriflavin resistance protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD