Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GamR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 6 3
Bacillus halodurans C-125 6 3
Bacillus licheniformis DSM 13 7 3
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168 3 2
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831 6 2
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
licH
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -97
score = 5.24467
sequence = AAATAGGTAGTTACAAATTT

Site:
position = -73
score = 5.6533
sequence = TGATTAGTAATTACAAATAT

Gene: ABC0643: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Bacillus halodurans C-125

Site:
position = -74
score = 5.55165
sequence = TGATTAGTAGTAACAAATAT

Gene: BH0912: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
*
Bacillus licheniformis DSM 13

Site:
position = -99
score = 6.23247
sequence = CAATTTGTTATAACAAATAT

Site:
position = -85
score = 4.5882
sequence = AAATATGTATGGACAAATTT

Site:
position = -71
score = 5.19774
sequence = AAATTTGTTATAACATGTTA

Gene: BLi00335: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
*
Oceanobacillus iheyensis HTE831

Site:
position = -126
score = 5.75644
sequence = AATTGTGTTATAACAAATTT

Gene: OB2273: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Paenibacillus sp. JDR-2
Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
ywbA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC5211: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Bacillus clausii KSM-K16

Gene: ABC0642: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Bacillus halodurans C-125

Gene: BH0911: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi00334: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2274: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
ywbB
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0641: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Bacillus halodurans C-125

Gene: BH0910: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi00333: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2275: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
ywbC
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0640: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Bacillus halodurans C-125

Gene: BH0909: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi00332: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2276: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
 
CRON 2.
chiA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC0429: Chitinase (EC 3.2.1.14)
*
Bacillus clausii KSM-K16

Site:
position = -60
score = 4.76597
sequence = GAATTAGTAGTAACAACTTT

Gene: ABC0646: Chitinase (EC 3.2.1.14)
*
Bacillus halodurans C-125

Site:
position = -92
score = 5.64757
sequence = ATATTTGTTATTACATTTAT

Site:
position = -68
score = 4.73071
sequence = ATTTTAGTAGTAACTTTTAT

Site:
position = -44
score = 5.2011
sequence = AATATTGTTACTACAAATAA

Gene: BH0916: Chitinase (EC 3.2.1.14)
*
Bacillus licheniformis DSM 13

Site:
position = -300
score = 6.21442
sequence = AAATTTGTCATAACAAATTT

Gene: BLi00338: Chitinase (EC 3.2.1.14)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB0791: Chitinase (EC 3.2.1.14)
 
Paenibacillus sp. JDR-2
Chitinase (EC 3.2.1.14)
 
CRON 3.
gamA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -75
score = 5.01924
sequence = AAATTCGTAATGACAAGTAT

Site:
position = -52
score = 5.91674
sequence = AAATTGGTCATAACAAATAT

Gene: BSU02360: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
gamP
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02350: PTS system, Glucosamine-specific IIB component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIC component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIA component (EC 2.7.1.69)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
PTS system, Glucosamine-specific IIB component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIC component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIA component (EC 2.7.1.69)
 
CRON 4.
gamR
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0645: Predicted transcriptional regulator of glucosamine utilization, GntR family
 
Bacillus halodurans C-125

Gene: BH0914: Predicted transcriptional regulator of glucosamine utilization, GntR family
*
Bacillus licheniformis DSM 13

Site:
position = -110
score = 5.19774
sequence = TAACATGTTATAACAAATTT

Site:
position = -96
score = 4.5882
sequence = AAATTTGTCCATACATATTT

Site:
position = -82
score = 6.23247
sequence = ATATTTGTTATAACAAATTG

Gene: BLi00336: Predicted transcriptional regulator of glucosamine utilization, GntR family
 
Bacillus pumilus SAFR-032
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -186
score = 5.91674
sequence = ATATTTGTTATGACCAATTT

Site:
position = -163
score = 5.01924
sequence = ATACTTGTCATTACGAATTT

Gene: BSU02370: Predicted transcriptional regulator of glucosamine utilization, GntR family
 
Geobacillus kaustophilus HTA426
*
Oceanobacillus iheyensis HTE831

Site:
position = -81
score = 5.75644
sequence = AAATTTGTTATAACACAATT

Gene: OB2272: Predicted transcriptional regulator of glucosamine utilization, GntR family
 
Paenibacillus sp. JDR-2
Predicted transcriptional regulator of glucosamine utilization, GntR family
BH0913
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC5208: Predicted chitooligosaccharide deacetylase
*
Bacillus clausii KSM-K16

Site:
position = -100
score = 5.24467
sequence = AAATTTGTAACTACCTATTT

Site:
position = -124
score = 5.6533
sequence = ATATTTGTAATTACTAATCA

Gene: ABC0644: Predicted chitooligosaccharide deacetylase
*
Bacillus halodurans C-125

Site:
position = -60
score = 4.55935
sequence = TTATACGTAATGACAATTTT

Site:
position = -92
score = 4.79076
sequence = TTAATTGTAGTTACTTATTT

Site:
position = -116
score = 5.55165
sequence = ATATTTGTTACTACTAATCA

Gene: BH0913: Predicted chitooligosaccharide deacetylase
 
Bacillus licheniformis DSM 13

Gene: BLi00337: Predicted chitooligosaccharide deacetylase
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2271: Predicted chitooligosaccharide deacetylase
 
Paenibacillus sp. JDR-2
Predicted chitooligosaccharide deacetylase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD