Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756 11 3
Caulobacter sp. K31 11 4
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3511
 
Caulobacter crescentus CB15
*
Caulobacter segnis ATCC 21756

Site:
position = -40
score = 5.99349
sequence = AATCTGGTCTATACCAAACT

Gene: Cseg_3204: phospholipase C, phosphocholine-specific
*
Caulobacter sp. K31

Site:
position = -39
score = 5.88797
sequence = ATTTTGGTCTATACCAGAAT

Site:
position = -115
score = 3.94805
sequence = CAACTGGATCAGACCACTGA

Gene: Caul_2987: phospholipase C, phosphocholine-specific
 
Phenylobacterium zucineum HLK1
phospholipase C, phosphocholine-specific
COG4341
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3205: Predicted HD phosphohydrolase
 
Caulobacter sp. K31

Gene: Caul_2988: Predicted HD phosphohydrolase
 
Phenylobacterium zucineum HLK1
Predicted HD phosphohydrolase
 
CRON 2.
phnR
 
Caulobacter crescentus CB15
*
Caulobacter segnis ATCC 21756

Site:
position = -151
score = 5.75107
sequence = AGTTTGGTATAGACCAGATT

Gene: Cseg_3203: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
*
Caulobacter sp. K31

Site:
position = -165
score = 6.42722
sequence = ATTCTGGTATAGACCAAAAT

Gene: Caul_2986: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Phenylobacterium zucineum HLK1
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Cseg_3202
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3202: conserved membrane protein, probable transporter
*
Caulobacter sp. K31

Site:
position = -40
score = 5.35722
sequence = GATTTGGTCTAGACCAGAAC

Gene: Caul_2985: conserved membrane protein, probable transporter
 
Phenylobacterium zucineum HLK1
conserved membrane protein, probable transporter
 
CRON 3.
omp
 
Caulobacter crescentus CB15
*
Caulobacter segnis ATCC 21756

Site:
position = -208
score = 5.13676
sequence = GATTTGGTATAGTCCAAAAT

Site:
position = -37
score = 4.6371
sequence = CCACTGGTCCATACCAGAGT

Gene: Cseg_3212: TonB-dependent receptor
*
Caulobacter sp. K31

Site:
position = -35
score = 5.15488
sequence = CAACTGGTTCATACCAGTTG

Gene: Caul_2995: TonB-dependent receptor
 
Phenylobacterium zucineum HLK1
TonB-dependent receptor
Cseg_3211
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3211: hypothetical protein
 
Caulobacter sp. K31

Gene: Caul_2994: hypothetical protein
 
Phenylobacterium zucineum HLK1
hypothetical protein
Cseg_3210
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3210: aspartyl/asparaginyl beta-hydroxylase
 
Caulobacter sp. K31

Gene: Caul_2993: aspartyl/asparaginyl beta-hydroxylase
 
Phenylobacterium zucineum HLK1
aspartyl/asparaginyl beta-hydroxylase
Cseg_3209
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3209: TPR repeat-containing protein
 
Caulobacter sp. K31

Gene: Caul_2992: TPR repeat-containing protein
 
Phenylobacterium zucineum HLK1
TPR repeat-containing protein
Cseg_3208
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3208: aspartyl/asparaginyl beta-hydroxylase
 
Caulobacter sp. K31

Gene: Caul_2991: aspartyl/asparaginyl beta-hydroxylase
 
Phenylobacterium zucineum HLK1
aspartyl/asparaginyl beta-hydroxylase
Cseg_3207
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3207: FAD dependent oxidoreductase
 
Caulobacter sp. K31

Gene: Caul_2990: FAD dependent oxidoreductase
 
Phenylobacterium zucineum HLK1
FAD dependent oxidoreductase
phnX
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3206: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Caulobacter sp. K31

Gene: Caul_2989: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Phenylobacterium zucineum HLK1
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD