Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057 5 2
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnW
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -21
score = 6.25144
sequence = CATCTGGTTTAAACCAGATT

Gene: AB57_1572: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
phnX
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_1573: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
CRON 2.
phnS
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -85
score = 6.43105
sequence = AATCTGGTTTAAACCAGATT

Gene: AB57_1568: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
phnT
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_1569: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_1570: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD