Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 4 4
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnS2
*
Hahella chejuensis KCTC 2396

Site:
position = -51
score = 6.27767
sequence = CTTCTGGTATAGACCAGAAG

Gene: HCH_03088: 2-aminoethylphosphonate ABC transporter, periplasmic binding component
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
2-aminoethylphosphonate ABC transporter, periplasmic binding component
 
CRON 2.
phnR2
*
Hahella chejuensis KCTC 2396

Site:
position = -28
score = 5.35496
sequence = TTTTTGGAATAGACCAGAAG

Gene: HCH_03089: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
CRON 3.
COG1409
*
Hahella chejuensis KCTC 2396

Site:
position = -275
score = 5.039
sequence = AATCTGGTTCGTACCAGTAG

Site:
position = -196
score = 4.56368
sequence = ATCTTGGTCCGAACCAGATG

Gene: HCH_00466: Predicted phosphohydrolase
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Predicted phosphohydrolase
 
CRON 4.
phnR1
*
Hahella chejuensis KCTC 2396

Site:
position = -188
score = 4.8586
sequence = CATCTGGTTCGGACCAAGAT

Site:
position = -109
score = 4.92485
sequence = CTACTGGTACGAACCAGATT

Gene: HCH_00465: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD