Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 7 2
Psychromonas sp. CNPT3 6 2
Moritella sp. PE36 7 3
Aeromonas hydrophila subsp. hydrophila ATCC 7966 7 4
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnS
*
Psychromonas ingrahamii 37

Site:
position = -52
score = 5.35388
sequence = AAACTGGTACATACCAATTA

Site:
position = -240
score = 5.29237
sequence = TTTTTGGTGTAGACCAGAAT

Gene: Ping_2746: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Psychromonas sp. CNPT3

Site:
position = -253
score = 5.43695
sequence = TATTTGGTGTAGACCAGAAT

Gene: PCNPT3_11559: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Moritella sp. PE36

Site:
position = -50
score = 6.21494
sequence = AATCTGGTACAGACCAGAAT

Site:
position = -261
score = 5.0096
sequence = CATTTGGACTATACCAGTTT

Gene: PE36_23512: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -39
score = 5.55911
sequence = AATCTGGTTTATACCAAGCC

Gene: AHA_1936: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
phnT
 
Psychromonas ingrahamii 37

Gene: Ping_2745: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11554: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Moritella sp. PE36

Site:
position = -24
score = 5.48285
sequence = ATACTGGTATAGTCCAAATA

Gene: PE36_23517: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -36
score = 6.07377
sequence = AAACTGGTATATACCAAATC

Gene: AHA_1935: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU
 
Psychromonas ingrahamii 37

Gene: Ping_2744: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11549: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Moritella sp. PE36

Gene: PE36_23522: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1934: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
phnR
 
Psychromonas ingrahamii 37

Gene: Ping_2743: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11544: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Moritella sp. PE36

Gene: PE36_23527: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -18
score = 5.95854
sequence = CTTTTGGTATATACCAGAAT

Gene: AHA_1937: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
phnW
*
Psychromonas ingrahamii 37

Site:
position = -227
score = 4.60903
sequence = TAATTGGTATGTACCAGTTT

Site:
position = -39
score = 5.94704
sequence = ATTCTGGTCTACACCAAAAA

Gene: Ping_2747: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Psychromonas sp. CNPT3

Site:
position = -32
score = 5.925
sequence = ATTCTGGTCTACACCAAATA

Gene: PCNPT3_11564: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Moritella sp. PE36

Site:
position = -228
score = 5.58652
sequence = ATTCTGGTCTGTACCAGATT

Site:
position = -17
score = 5.66246
sequence = AAACTGGTATAGTCCAAATG

Gene: PE36_23507: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -166
score = 4.21173
sequence = ACGTTGGTAGATACCAGTAT

Site:
position = -30
score = 6.36868
sequence = ATTCTGGTATATACCAAAAG

Gene: AHA_1938: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
COG0160
 
Psychromonas ingrahamii 37

Gene: Ping_2748: 4-aminobutyrate aminotransferase and related aminotransferases
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_23502: 4-aminobutyrate aminotransferase and related aminotransferases
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1939: 4-aminobutyrate aminotransferase and related aminotransferases
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
4-aminobutyrate aminotransferase and related aminotransferases
phnX
 
Psychromonas ingrahamii 37

Gene: Ping_2749: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11569: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Moritella sp. PE36

Gene: PE36_23497: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1940: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD