Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 8 3
Vibrio vulnificus CMCP6 9 3
Vibrio harveyi ATCC BAA-1116 8 3
Vibrio parahaemolyticus RIMD 2210633 15 5
Vibrio shilonii AK1 14 5
Vibrio splendidus LGP32 9 3
Vibrio fischeri ES114 6 1
Vibrio salmonicida LFI1238 11 4
Vibrio angustum S14 8 4
Photobacterium profundum SS9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnW
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -28
score = 5.19134
sequence = TTATTGGTATAGTCCAAAAA

Site:
position = -224
score = 5.68824
sequence = AATTTGGTATGTACCAGAAT

Gene: VCA0604: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio vulnificus CMCP6

Site:
position = -228
score = 5.3663
sequence = ATTTTGGTCTGTACCAGTTG

Site:
position = -30
score = 5.03519
sequence = TTTCTGGTGTAGACCAATTA

Gene: VV21664: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -139
score = 5.43841
sequence = AATTTGGTCTGTACCAGTTG

Site:
position = 57
score = 5.65187
sequence = AATTTGGTATATACCAACAA

Gene: VIBHAR_04876: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -42
score = 5.03519
sequence = TTTCTGGTGTAGACCAATTA

Site:
position = -240
score = 5.3663
sequence = ATTTTGGTCTGTACCAGTTG

Gene: VPA0235: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio shilonii AK1

Site:
position = -209
score = 5.0159
sequence = GATTTGGTCTGTACCAGTTT

Site:
position = -30
score = 5.52055
sequence = AAATTGGTATAGTCCAAATA

Gene: VSAK1_17767: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio splendidus LGP32

Site:
position = -34
score = 5.37675
sequence = ATACTGGTATAGTCCAAAAT

Site:
position = -222
score = 5.25171
sequence = ACATTGGTATGTACCAGATG

Gene: VS_II0398: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -18
score = 5.57484
sequence = AAACTGATATATACCAAAAT

Site:
position = -205
score = 5.43822
sequence = AAATTGGTATGTACCATTAA

Gene: VSAL_II0812: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
*
Vibrio angustum S14

Site:
position = -30
score = 5.43841
sequence = AAACTGGTATAGTCCAAATG

Site:
position = -231
score = 5.65573
sequence = ATTTTGGTATGTACCAGTTT

Gene: VAS14_11014: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Photobacterium profundum SS9
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
COG0160
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0605: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio vulnificus CMCP6

Gene: VV21663: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04875: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0234: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio shilonii AK1

Gene: VSAK1_17772: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio splendidus LGP32

Gene: VS_II0397: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0813: 4-aminobutyrate aminotransferase and related aminotransferases
 
Vibrio angustum S14

Gene: VAS14_11019: 4-aminobutyrate aminotransferase and related aminotransferases
 
Photobacterium profundum SS9
4-aminobutyrate aminotransferase and related aminotransferases
phnX
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0606: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio vulnificus CMCP6

Gene: VV21662: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04874: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0233: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio shilonii AK1

Gene: VSAK1_17777: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio splendidus LGP32

Gene: VS_II0396: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0814: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Vibrio angustum S14

Gene: VAS14_11024: 2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Photobacterium profundum SS9
2-phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
CRON 2.
phnT
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 6
score = 5.66595
sequence = ATTTTGGACTATACCAAATT

Gene: VCA0602: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio vulnificus CMCP6

Site:
position = -31
score = 5.90404
sequence = AATTTGGTATATACCATTTG

Gene: VV21669: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -31
score = 5.60933
sequence = AAGTTGGTATATACCATTTG

Gene: VIBHAR_04880: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -31
score = 5.60933
sequence = AAGTTGGTATATACCATTTG

Gene: VPA0238: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio shilonii AK1

Site:
position = -31
score = 5.90404
sequence = AATTTGGTATATACCATTTG

Site:
position = -53
score = 4.72749
sequence = CCAATGAAATATACCAGATT

Gene: VSAK1_17757: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio splendidus LGP32

Site:
position = -34
score = 5.4677
sequence = AATTTGGTATATACCATGTA

Gene: VS_II0401: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -31
score = 5.37495
sequence = TATTTGGAGTATACCAAATG

Gene: VSAL_II0810: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
*
Vibrio angustum S14

Site:
position = -35
score = 5.98618
sequence = AATTTGGTATATACCAATTA

Gene: VAS14_10979: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Photobacterium profundum SS9
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0601: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio vulnificus CMCP6

Gene: VV21670: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04881: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0239: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio shilonii AK1

Gene: VSAK1_17752: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio splendidus LGP32

Gene: VS_II0402: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10974: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
 
Photobacterium profundum SS9
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.
phnR
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0600: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio vulnificus CMCP6

Gene: VV21671: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04882: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0240: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio shilonii AK1

Gene: VSAK1_17747: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio splendidus LGP32

Gene: VS_II0403: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_10969: 2-aminoethylphosphonate utilization regulator, GntR family
 
Photobacterium profundum SS9
2-aminoethylphosphonate utilization regulator, GntR family
VCA0599
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0599: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio vulnificus CMCP6

Gene: VV21672: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04883: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0241: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio shilonii AK1

Gene: VSAK1_17742: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio splendidus LGP32

Gene: VS_II0404: Permease of the drug/metabolite transporter (DMT) superfamily
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Permease of the drug/metabolite transporter (DMT) superfamily
VV21673
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21673: Glycine/D-amino acid oxidase
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_04889: Glycine/D-amino acid oxidase
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0244: Glycine/D-amino acid oxidase
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0400: Glycine/D-amino acid oxidase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -35
score = 4.95887
sequence = TTAGTGGTCTATACCAATTA

Gene: VAS14_11029: Glycine/D-amino acid oxidase
 
Photobacterium profundum SS9
Glycine/D-amino acid oxidase
phnS
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -27
score = 5.68824
sequence = ATTCTGGTACATACCAAATT

Site:
position = -223
score = 5.19134
sequence = TTTTTGGACTATACCAATAA

Gene: VCA0603: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio vulnificus CMCP6

Site:
position = -48
score = 5.3663
sequence = CAACTGGTACAGACCAAAAT

Site:
position = -246
score = 5.03519
sequence = TAATTGGTCTACACCAGAAA

Gene: VV21665: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -47
score = 5.43841
sequence = CAACTGGTACAGACCAAATT

Site:
position = -243
score = 5.65187
sequence = TTGTTGGTATATACCAAATT

Gene: VIBHAR_04877: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -246
score = 5.03519
sequence = TAATTGGTCTACACCAGAAA

Site:
position = -48
score = 5.3663
sequence = CAACTGGTACAGACCAAAAT

Gene: VPA0236: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio shilonii AK1

Site:
position = -35
score = 5.0159
sequence = AAACTGGTACAGACCAAATC

Site:
position = -214
score = 5.52055
sequence = TATTTGGACTATACCAATTT

Gene: VSAK1_17762: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio splendidus LGP32

Site:
position = -380
score = 5.37675
sequence = ATTTTGGACTATACCAGTAT

Site:
position = -192
score = 5.25171
sequence = CATCTGGTACATACCAATGT

Gene: VS_II0399: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = 15
score = 5.43822
sequence = TTAATGGTACATACCAATTT

Site:
position = -172
score = 5.57484
sequence = ATTTTGGTATATATCAGTTT

Gene: VSAL_II0811: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio angustum S14

Site:
position = -62
score = 5.65573
sequence = AAACTGGTACATACCAAAAT

Gene: VAS14_11009: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Photobacterium profundum SS9
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
CRON 3.
phnS2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -211
score = 4.16886
sequence = ATTCTGACCTAGTCCAATAG

Site:
position = -30
score = 3.79928
sequence = TTACTGACCTAGTCCAGAAG

Gene: VPA0354: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio shilonii AK1

Site:
position = -30
score = 3.47781
sequence = TTACTGACCTAGTCCAGAGG

Gene: VSAK1_19529: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -31
score = 4.65171
sequence = TTATTGATGTAGTCCAAAAG

Gene: VF_A1087: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Vibrio salmonicida LFI1238

Site:
position = -31
score = 4.65171
sequence = TTATTGATGTAGTCCAAAAG

Gene: VSAL_II1027: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0175: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
PF01663
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0353: type I phosphodiesterase
 
Vibrio shilonii AK1

Gene: VSAK1_19524: type I phosphodiesterase
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A1088: type I phosphodiesterase
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1028: type I phosphodiesterase
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0176: type I phosphodiesterase
type I phosphodiesterase
phnU2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0352: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Vibrio shilonii AK1

Gene: VSAK1_19519: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A1089: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1029: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0177: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0351: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Vibrio shilonii AK1

Gene: VSAK1_19514: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A1090: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1030: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0178: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnT2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0350: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Vibrio shilonii AK1

Gene: VSAK1_19509: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A1091: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1031: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB0179: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
COG0560
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0349: Phosphoserine phosphatase (EC 3.1.3.3)
 
Vibrio shilonii AK1

Gene: VSAK1_19504: Phosphoserine phosphatase (EC 3.1.3.3)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_A1092: Phosphoserine phosphatase (EC 3.1.3.3)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II1032: Phosphoserine phosphatase (EC 3.1.3.3)
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Phosphoserine phosphatase (EC 3.1.3.3)
 
CRON 4.
phnR2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -18
score = 3.56252
sequence = CTATTGGACTAGGTCAGAAT

Gene: VPA0355: 2-aminoethylphosphonate utilization regulator, GntR family
*
Vibrio shilonii AK1

Site:
position = -123
score = 3.47781
sequence = CCTCTGGACTAGGTCAGTAA

Gene: VSAK1_19534: 2-aminoethylphosphonate utilization regulator, GntR family
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
2-aminoethylphosphonate utilization regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD