Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655
Salmonella typhimurium LT2 7 3
Citrobacter koseri ATCC BAA-895
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 7 3
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnR
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -131
score = 5.29201
sequence = CCTTTGGTCTATACCAGATT

Gene: STM0430: 2-aminoethylphosphonate utilization regulator, GntR family
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -153
score = 5.8309
sequence = CATTTGGTCTATACCAGATT

Gene: KPN_04062: 2-aminoethylphosphonate utilization regulator, GntR family
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate utilization regulator, GntR family
 
CRON 2.
phnS
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -48
score = 6.02449
sequence = AACCTGGTATAGGCCAGAAA

Gene: STM0429: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -45
score = 6.21525
sequence = AATCTGGTCTACACCAGAAT

Gene: KPN_04061: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
phnT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0428: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04060: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0427: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04059: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0426: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04058: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
CRON 3.
phnW
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -28
score = 6.24367
sequence = AATCTGGTATAGACCAAAGG

Gene: STM0431: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -29
score = 6.52049
sequence = AATCTGGTATAGACCAAATG

Gene: KPN_04063: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
phnX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0432: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04064: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3079: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
 
Photorhabdus luminescens subsp. laumondii TTO1
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD