Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnF - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222 8 2
Jannaschia sp. CCS1 2 2
Rhodobacterales bacterium HTCC2654 9 2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53 8 2
Oceanicola batsensis HTCC2597 10 2
Roseovarius nubinhibens ISM 9 2
Roseovarius sp. 217 10 2
Sulfitobacter sp. EE-36 8 2
Silicibacter TM1040 7 1
Silicibacter pomeroyi DSS-3 8 2
Roseobacter sp. MED193 4 2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnG
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -53
score = 5.64863
sequence = TTGTCTAGTTGTATAGAAAA

Site:
position = -45
score = 5.77579
sequence = TTGTATAGAAAACTAGACAA

Gene: Pden_4782: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -37
score = 5.058
sequence = TTGTATAGTAGCGTAGACAA

Gene: RB2654_09754: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Oceanicola granulosus HTCC2516
*
Loktanella vestfoldensis SKA53

Site:
position = -37
score = 5.06879
sequence = TTGTCTAGTTGTATAGTAAA

Gene: SKA53_06737: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Oceanicola batsensis HTCC2597

Site:
position = -37
score = 5.93846
sequence = TTGTATAGGTAAATAGACAA

Gene: OB2597_05575: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Roseovarius nubinhibens ISM

Site:
position = -39
score = 5.55379
sequence = TTGTATAATAACATAGACAA

Gene: ISM_06260: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Roseovarius sp. 217

Site:
position = -49
score = 5.52592
sequence = TTGTATAGTGATATCGACAA

Gene: ROS217_04235: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Sulfitobacter sp. EE-36

Site:
position = -37
score = 6.19612
sequence = TTGTCTAGTTGTATAGACAA

Gene: EE36_08873: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Silicibacter TM1040

Site:
position = -53
score = 4.48895
sequence = TTGTCTAGTTGTATAGGACA

Gene: TM1040_3703: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Silicibacter pomeroyi DSS-3

Site:
position = -47
score = 5.06879
sequence = TTGTCTAGTTGTATAGTGAA

Gene: SPO0468: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Roseobacter sp. MED193

Site:
position = -52
score = 5.06879
sequence = TTGTCTAGTTGTATAGAACA

Gene: MED193_17604: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4781: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09749: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06732: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05570: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Roseovarius nubinhibens ISM

Gene: ISM_06255: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Roseovarius sp. 217

Gene: ROS217_04240: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Sulfitobacter sp. EE-36

Gene: EE36_08878: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Silicibacter TM1040

Gene: TM1040_3702: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Silicibacter pomeroyi DSS-3

Gene: SPO0469: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Roseobacter sp. MED193

Gene: MED193_17609: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4780: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09744: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06727: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05565: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Roseovarius nubinhibens ISM

Gene: ISM_06250: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Roseovarius sp. 217

Gene: ROS217_04245: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Sulfitobacter sp. EE-36

Gene: EE36_08883: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Silicibacter TM1040

Gene: TM1040_3701: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Silicibacter pomeroyi DSS-3

Gene: SPO0470: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Roseobacter sp. MED193

Gene: MED193_17614: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Pden_0043
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09739: Hydrolase, haloacid dehalogenase-like family
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_04250: Hydrolase, haloacid dehalogenase-like family
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hydrolase, haloacid dehalogenase-like family
phnJ
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4779: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09734: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06722: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05555: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Roseovarius nubinhibens ISM

Gene: ISM_06245: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Roseovarius sp. 217

Gene: ROS217_04255: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Sulfitobacter sp. EE-36

Gene: EE36_08888: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Silicibacter TM1040

Gene: TM1040_3700: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Silicibacter pomeroyi DSS-3

Gene: SPO0471: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Roseobacter sp. MED193

Gene: MED193_17624: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4778: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09729: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06717: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05550: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Roseovarius nubinhibens ISM

Gene: ISM_06240: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Roseovarius sp. 217

Gene: ROS217_04260: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Sulfitobacter sp. EE-36

Gene: EE36_08893: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Silicibacter TM1040

Gene: TM1040_3699: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Silicibacter pomeroyi DSS-3

Gene: SPO0472: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Roseobacter sp. MED193

Gene: MED193_17629: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
corA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_04265: magnesium/cobalt transport protein, MIT family
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
magnesium/cobalt transport protein, MIT family
phnL
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4777: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09724: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06712: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05545: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Roseovarius nubinhibens ISM

Gene: ISM_06235: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Roseovarius sp. 217

Gene: ROS217_04270: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Sulfitobacter sp. EE-36

Gene: EE36_08898: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Silicibacter TM1040

Gene: TM1040_3698: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Silicibacter pomeroyi DSS-3

Gene: SPO0473: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Roseobacter sp. MED193

Gene: MED193_17634: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnN
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4776: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
*
Jannaschia sp. CCS1

Site:
position = -29
score = 5.28025
sequence = TTGTATAATTAAATGGACAA

Gene: Jann_2855: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09719: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06707: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05540: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Roseovarius nubinhibens ISM

Gene: ISM_06230: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Roseovarius sp. 217

Gene: ROS217_04275: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Sulfitobacter sp. EE-36

Gene: EE36_08903: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Silicibacter TM1040

Gene: TM1040_3697: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0474: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Roseobacter sp. MED193

Gene: MED193_17639: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
OB2597_05560
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05560: hypothetical protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
phnM
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4421: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Jannaschia sp. CCS1

Gene: Jann_2853: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06697: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Oceanicola batsensis HTCC2597

Gene: OB2597_05535: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Roseovarius nubinhibens ISM

Gene: ISM_06225: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3695: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Silicibacter pomeroyi DSS-3

Gene: SPO0476: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Roseobacter sp. MED193

Gene: MED193_17649: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
CRON 2.
phnF
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -85
score = 5.42379
sequence = TTTTCTATACAACTAGACAA

Site:
position = -93
score = 5.92641
sequence = TTGTCTAGTTTTCTATACAA

Gene: Pden_4783: Transcriptional regulator for phosphonate utilization, GntR family
*
Jannaschia sp. CCS1

Site:
position = -85
score = 5.27054
sequence = TTGTCCATTTAATTATACAA

Gene: Jann_2856: Transcriptional regulator for phosphonate utilization, GntR family
*
Rhodobacterales bacterium HTCC2654

Site:
position = -75
score = 4.96822
sequence = TTGTCTACGCTACTATACAA

Gene: RB2654_09759: Transcriptional regulator for phosphonate utilization, GntR family
 
Oceanicola granulosus HTCC2516
*
Loktanella vestfoldensis SKA53

Site:
position = -71
score = 4.84395
sequence = TTTACTATACAACTAGACAA

Gene: SKA53_06742: Transcriptional regulator for phosphonate utilization, GntR family
*
Oceanicola batsensis HTCC2597

Site:
position = -79
score = 5.95419
sequence = TTGTCTATTTACCTATACAA

Gene: OB2597_05580: Transcriptional regulator for phosphonate utilization, GntR family
*
Roseovarius nubinhibens ISM

Site:
position = -94
score = 5.50138
sequence = TTGTCTATGTTATTATACAA

Gene: ISM_06265: Transcriptional regulator for phosphonate utilization, GntR family
*
Roseovarius sp. 217

Site:
position = -85
score = 5.3902
sequence = TTGTCGATATCACTATACAA

Gene: ROS217_04230: Transcriptional regulator for phosphonate utilization, GntR family
*
Sulfitobacter sp. EE-36

Site:
position = -76
score = 6.00362
sequence = TTGTCTATACAACTAGACAA

Gene: EE36_08868: Transcriptional regulator for phosphonate utilization, GntR family
 
Silicibacter TM1040

Gene: TM1040_3704: Transcriptional regulator for phosphonate utilization, GntR family
*
Silicibacter pomeroyi DSS-3

Site:
position = -76
score = 4.84395
sequence = TTCACTATACAACTAGACAA

Gene: SPO0467: Transcriptional regulator for phosphonate utilization, GntR family
*
Roseobacter sp. MED193

Site:
position = -76
score = 4.84395
sequence = TGTTCTATACAACTAGACAA

Gene: MED193_17599: Transcriptional regulator for phosphonate utilization, GntR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transcriptional regulator for phosphonate utilization, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD