Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnF - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 8 2
Rhizobium sp. NGR234 8 2
Rhizobium leguminosarum bv. viciae 3841 9 2
Rhizobium etli CFN 42 15 2
Agrobacterium tumefaciens str. C58 (Cereon) 8 2
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099 4 2
Brucella melitensis 16M 2 2
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009 9 2
Bradyrhizobium japonicum USDA 110 9 2
Bradyrhizobium sp. BTAi1 9 2
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571 1 1
Xanthobacter autotrophicus Py2 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnG
*
Sinorhizobium meliloti 1021

Site:
position = -31
score = 6.20626
sequence = TTGTCTAGATCAATAGACAT

Gene: SMb20759: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Rhizobium sp. NGR234

Site:
position = -34
score = 6.20626
sequence = TTGTCTAGATCAATAGACAT

Gene: NGR_b21010: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -36
score = 6.3856
sequence = TTGTCTATATCAATAGACAT

Gene: RL0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Rhizobium etli CFN 42

Site:
position = -35
score = 6.3856
sequence = TTGTCTATATCAATAGACAT

Gene: RHE_CH00167: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -33
score = 6.3856
sequence = TTGTCTATATCAATAGACAT

Gene: Atu0181: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Mesorhizobium sp. BNC1
*3
Mesorhizobium loti MAFF303099

Site:
position = -44
score = 6.61599
sequence = TTGTCTATATCAATAGACAA

Gene: mlr3342: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG

Gene: mll9155: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG

Gene: mlr9277: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -39
score = 6.50713
sequence = TTGTCTATTAACATAGACAA

Gene: RPA0695: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Bradyrhizobium japonicum USDA 110

Site:
position = 6
score = 6.04801
sequence = TTGTCTACTATCATAGACAA

Gene: blr1221: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Bradyrhizobium sp. BTAi1

Site:
position = -72
score = 6.42903
sequence = TTGTCTATTATCATAGACAA

Gene: BBta_5848: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3392: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Xanthobacter autotrophicus Py2

Site:
position = -104
score = 5.5744
sequence = TTGTCTATTTGTCTAGACTA

Gene: Xaut_1316: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH
 
Sinorhizobium meliloti 1021

Gene: SMb20760: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Rhizobium sp. NGR234

Gene: NGR_b21020: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Rhizobium etli CFN 42

Gene: RHE_CH00166: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0180: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Mesorhizobium sp. BNC1
 3
Mesorhizobium loti MAFF303099

Gene: mlr3343: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH

Gene: mll9154: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH

Gene: mlr9279: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0694: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Bradyrhizobium japonicum USDA 110

Gene: blr1222: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5847: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3393: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1315: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI
 
Sinorhizobium meliloti 1021

Gene: SMb20761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Rhizobium sp. NGR234

Gene: NGR_b21030: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0175: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Rhizobium etli CFN 42

Gene: RHE_CH00165: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0179: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Mesorhizobium sp. BNC1
 3
Mesorhizobium loti MAFF303099

Gene: mlr3344: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI

Gene: mll9153: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI

Gene: mlr9280: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0693: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Bradyrhizobium japonicum USDA 110

Gene: blr1223: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5846: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3394: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1314: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ
 
Sinorhizobium meliloti 1021

Gene: SMb20762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Rhizobium sp. NGR234

Gene: NGR_b21040: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0174: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Rhizobium etli CFN 42

Gene: RHE_CH00164: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0178: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Mesorhizobium sp. BNC1
 3
Mesorhizobium loti MAFF303099

Gene: mlr3346: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ

Gene: mll9152: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ

Gene: mlr9282: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0692: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Bradyrhizobium japonicum USDA 110

Gene: blr1224: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5845: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3395: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1313: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK
 
Sinorhizobium meliloti 1021

Gene: SMb20763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Rhizobium sp. NGR234

Gene: NGR_b21050: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0173: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Rhizobium etli CFN 42

Gene: RHE_CH00163: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0177: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Mesorhizobium sp. BNC1
 4
Mesorhizobium loti MAFF303099

Gene: mlr3347: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK

Gene: mll9151: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK

Gene: msr9284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK

Gene: mlr9283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0691: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Bradyrhizobium japonicum USDA 110

Gene: blr1225: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5844: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3397: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1312: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL
 
Sinorhizobium meliloti 1021

Gene: SMb20764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Rhizobium sp. NGR234

Gene: NGR_b21060: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0172: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Rhizobium etli CFN 42

Gene: RHE_CH00162: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0176: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Mesorhizobium sp. BNC1
 3
Mesorhizobium loti MAFF303099

Gene: mlr3349: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL

Gene: mll9150: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL

Gene: mlr9286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0690: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Bradyrhizobium japonicum USDA 110

Gene: blr1226: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5843: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3398: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1311: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnO
 
Sinorhizobium meliloti 1021

Gene: SMb20765: Aminoalkylphosphonic acid N-acetyltransferase
 
Rhizobium sp. NGR234

Gene: NGR_b21070: Aminoalkylphosphonic acid N-acetyltransferase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0171: Aminoalkylphosphonic acid N-acetyltransferase
 
Rhizobium etli CFN 42

Gene: RHE_CH00161: Aminoalkylphosphonic acid N-acetyltransferase
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0175: Aminoalkylphosphonic acid N-acetyltransferase
 
Mesorhizobium sp. BNC1
 2
Mesorhizobium loti MAFF303099

Gene: mlr3351: Aminoalkylphosphonic acid N-acetyltransferase

Gene: mll1530: Aminoalkylphosphonic acid N-acetyltransferase
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0701: Aminoalkylphosphonic acid N-acetyltransferase
 
Bradyrhizobium japonicum USDA 110

Gene: blr7948: Aminoalkylphosphonic acid N-acetyltransferase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5859: Aminoalkylphosphonic acid N-acetyltransferase
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0705: Aminoalkylphosphonic acid N-acetyltransferase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1753: Aminoalkylphosphonic acid N-acetyltransferase
Aminoalkylphosphonic acid N-acetyltransferase
phnC
 
Sinorhizobium meliloti 1021

Gene: SMb21177: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Rhizobium sp. NGR234

Gene: NGR_b13340: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0170: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00160: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0174: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr3353: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0700: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll7947: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5858: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1058: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1322: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnD
 
Sinorhizobium meliloti 1021

Gene: SMb21176: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Rhizobium sp. NGR234

Gene: NGR_b13330: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0168: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00159: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0173: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr3355: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0699: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll7946: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5857: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1057: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1321: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnE2
 
Sinorhizobium meliloti 1021

Gene: SMb21175: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Rhizobium sp. NGR234

Gene: NGR_b13320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0167: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00158: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0172: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr3356: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0698: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll7945: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5856: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1056: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1320: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1)
phnE
 
Sinorhizobium meliloti 1021

Gene: SMb21174: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Rhizobium sp. NGR234

Gene: NGR_b13310: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0166: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00157: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0171: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Mesorhizobium sp. BNC1
 2
Mesorhizobium loti MAFF303099

Gene: mlr3359: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)

Gene: mlr3358: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0697: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll7944: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5855: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1055: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1319: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
Phosphonate ABC transporter permease protein (TC 3.A.1.9.1)
rcsF
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234

Gene: NGR_b13300: Protein RcsF involved in phosphonates utilization
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0165: Protein RcsF involved in phosphonates utilization
 
Rhizobium etli CFN 42

Gene: RHE_CH00156: Protein RcsF involved in phosphonates utilization
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0170: Protein RcsF involved in phosphonates utilization
 
Mesorhizobium sp. BNC1
 2
Mesorhizobium loti MAFF303099

Gene: mll4975: Protein RcsF involved in phosphonates utilization

Gene: mlr9287: Protein RcsF involved in phosphonates utilization
 
Brucella melitensis 16M

Gene: BMEI1107: Protein RcsF involved in phosphonates utilization
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0703: Protein RcsF involved in phosphonates utilization
 
Bradyrhizobium japonicum USDA 110

Gene: blr7950: Protein RcsF involved in phosphonates utilization
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5861: Protein RcsF involved in phosphonates utilization
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0704: Protein RcsF involved in phosphonates utilization
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1754: Protein RcsF involved in phosphonates utilization
Protein RcsF involved in phosphonates utilization
phnM
 
Sinorhizobium meliloti 1021

Gene: SMb21171: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Rhizobium sp. NGR234

Gene: NGR_b13290: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0164: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Rhizobium etli CFN 42

Gene: RHE_CH00155: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0169: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Mesorhizobium sp. BNC1
 3
Mesorhizobium loti MAFF303099

Gene: mll4974: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase

Gene: mlr9276: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase

Gene: mll9156: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Brucella melitensis 16M

Gene: BMEI1106: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0689: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Bradyrhizobium japonicum USDA 110

Gene: blr1227: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5842: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3399: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1310: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
phnN
 
Sinorhizobium meliloti 1021

Gene: SMb21170: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Rhizobium sp. NGR234

Gene: NGR_b13280: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0163: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Rhizobium etli CFN 42

Gene: RHE_CH00154: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0168: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Mesorhizobium sp. BNC1
 2
Mesorhizobium loti MAFF303099

Gene: mll4973: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)

Gene: mlr9288: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
*
Brucella melitensis 16M

Site:
position = -136
score = 6.11425
sequence = TTATCTATATAAATAGACAA

Gene: BMEI0882: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA0688: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Bradyrhizobium japonicum USDA 110

Gene: blr1228: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5841: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3400: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1309: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
CRON 2.
phnF
*
Sinorhizobium meliloti 1021

Site:
position = -111
score = 6.20963
sequence = ATGTCTATTGATCTAGACAA

Gene: SM_b20758: Transcriptional regulator for phosphonate utilization, GntR family
*
Rhizobium sp. NGR234

Site:
position = -73
score = 6.20963
sequence = ATGTCTATTGATCTAGACAA

Gene: NGR_b21000: Transcriptional regulator for phosphonate utilization, GntR family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -101
score = 6.43085
sequence = ATGTCTATTGATATAGACAA

Gene: RL0178: Transcriptional regulator for phosphonate utilization, GntR family
*
Rhizobium etli CFN 42

Site:
position = -94
score = 6.43085
sequence = ATGTCTATTGATATAGACAA

Gene: RHE_CH00168: Transcriptional regulator for phosphonate utilization, GntR family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -69
score = 6.43085
sequence = ATGTCTATTGATATAGACAA

Gene: Atu0182: Transcriptional regulator for phosphonate utilization, GntR family
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -96
score = 6.70983
sequence = TTGTCTATTGATATAGACAA

Gene: mll3341: Transcriptional regulator for phosphonate utilization, GntR family
*
Brucella melitensis 16M

Site:
position = -70
score = 6.59941
sequence = TTGTCTATTTATATAGATAA

Gene: BMEI0881: Transcriptional regulator for phosphonate utilization, GntR family
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -92
score = 6.46443
sequence = TTGTCTATGTTAATAGACAA

Gene: RPA0696: Transcriptional regulator for phosphonate utilization, GntR family
*
Bradyrhizobium japonicum USDA 110

Site:
position = -88
score = 5.9807
sequence = TTGTCTATGATAGTAGACAA

Gene: bll1220: Transcriptional regulator for phosphonate utilization, GntR family
*
Bradyrhizobium sp. BTAi1

Site:
position = -91
score = 6.37142
sequence = TTGTCTATGATAATAGACAA

Gene: BBta_5849: Transcriptional regulator for phosphonate utilization, GntR family
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -63
score = 4.56383
sequence = TTGTATAAAAGTCTATACAA

Site:
position = -55
score = 4.78619
sequence = AAGTCTATACAAATAGGCAA

Gene: AZC_3391: Transcriptional regulator for phosphonate utilization, GntR family
*
Xanthobacter autotrophicus Py2

Site:
position = -47
score = 5.46566
sequence = TAGTCTAGACAAATAGACAA

Gene: Xaut_1317: Transcriptional regulator for phosphonate utilization, GntR family
Transcriptional regulator for phosphonate utilization, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD