Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnF - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T
Dechloromonas aromatica RCB
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472 10 2
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9 9 2
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnF
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -121
score = 6.23744
sequence = TATAAACGTATAGACGTATCCA

Gene: CV1847: Transcriptional regulator for phosphonate utilization, GntR family
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -114
score = 6.23744
sequence = TATAAACGTATAGACGTATCCA

Gene: LHK_01588: Transcriptional regulator for phosphonate utilization, GntR family
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Transcriptional regulator for phosphonate utilization, GntR family
rcsF
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1848: Protein RcsF involved in phosphonates utilization
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Protein RcsF involved in phosphonates utilization
phnN
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1849: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01589: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
CRON 2.
phnG
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -51
score = 6.23744
sequence = TGGATACGTCTATACGTTTATA

Gene: CV1846: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -48
score = 6.23744
sequence = TGGATACGTCTATACGTTTATA

Gene: LHK_01587: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1845: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01586: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1844: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01585: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1843: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01584: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1842: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01583: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1841: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01582: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnM
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV1840: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01581: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD