Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnF - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 13 3
Burkholderia mallei ATCC 23344 9 3
Burkholderia sp. 383
Burkholderia cepacia AMMD
Burkholderia vietnamiensis G4
Burkholderia glumae BGR1
Burkholderia xenovorans LB400 13 3
Burkholderia phymatum STM815 13 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnG
*
Burkholderia pseudomallei K96243

Site:
position = -66
score = 6.85675
sequence = TATAGACGTCTAGACGTTTAGA

Gene: BPSL2857: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Burkholderia mallei ATCC 23344

Site:
position = -66
score = 6.85675
sequence = TATAGACGTCTAGACGTTTAGA

Gene: BMA2400: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -68
score = 7.26526
sequence = CCTAAACGTCTAGACGTTTAGA

Gene: Bxe_B2179: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Burkholderia phymatum STM815

Site:
position = -90
score = 6.80465
sequence = TACAAACGTCTAGACGTTTAGA

Gene: Bphy_3773: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH
 
Burkholderia pseudomallei K96243

Gene: BPSL2856: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Burkholderia mallei ATCC 23344

Gene: BMA2401: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2180: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Burkholderia phymatum STM815

Gene: Bphy_3774: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI
 
Burkholderia pseudomallei K96243

Gene: BPSL2855: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Burkholderia mallei ATCC 23344

Gene: BMA2402: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2181: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Burkholderia phymatum STM815

Gene: Bphy_3775: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ
 
Burkholderia pseudomallei K96243

Gene: BPSL2854: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Burkholderia mallei ATCC 23344

Gene: BMA2403: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2182: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Burkholderia phymatum STM815

Gene: Bphy_3776: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK
 
Burkholderia pseudomallei K96243

Gene: BPSL2853: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Burkholderia mallei ATCC 23344

Gene: BMA2404: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2183: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Burkholderia phymatum STM815

Gene: Bphy_3777: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL
 
Burkholderia pseudomallei K96243

Gene: BPSL2852: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2184: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Burkholderia phymatum STM815

Gene: Bphy_3778: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnM
 
Burkholderia pseudomallei K96243

Gene: BPSL2851: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Burkholderia mallei ATCC 23344

Gene: BMA2406: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2185: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Burkholderia phymatum STM815

Gene: Bphy_3779: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
CRON 2.
phnF
*
Burkholderia pseudomallei K96243

Site:
position = -88
score = 6.85675
sequence = TCTAAACGTCTAGACGTCTATA

Gene: BPSL2858: Transcriptional regulator for phosphonate utilization, GntR family
*
Burkholderia mallei ATCC 23344

Site:
position = -130
score = 6.85675
sequence = TCTAAACGTCTAGACGTCTATA

Gene: BMA2399: Transcriptional regulator for phosphonate utilization, GntR family
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -135
score = 7.26526
sequence = TCTAAACGTCTAGACGTTTAGG

Gene: Bxe_B2178: Transcriptional regulator for phosphonate utilization, GntR family
*
Burkholderia phymatum STM815

Site:
position = -128
score = 6.80465
sequence = TCTAAACGTCTAGACGTTTGTA

Gene: Bphy_3772: Transcriptional regulator for phosphonate utilization, GntR family
Transcriptional regulator for phosphonate utilization, GntR family
rcsF
 
Burkholderia pseudomallei K96243

Gene: BPSL2859: Protein RcsF involved in phosphonates utilization
 
Burkholderia mallei ATCC 23344

Gene: BMA2398: Protein RcsF involved in phosphonates utilization
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2177: Protein RcsF involved in phosphonates utilization
 
Burkholderia phymatum STM815

Gene: Bphy_3771: Protein RcsF involved in phosphonates utilization
Protein RcsF involved in phosphonates utilization
phnN
 
Burkholderia pseudomallei K96243

Gene: BPSL2860: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Burkholderia mallei ATCC 23344

Gene: BMA2397: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B2176: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Burkholderia phymatum STM815

Gene: Bphy_3770: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
CRON 3.
phnC
*
Burkholderia pseudomallei K96243

Site:
position = -61
score = 5.31238
sequence = GAAAAACATCTAGACGTATATA

Site:
position = -53
score = 5.31419
sequence = TCTAGACGTATATACGGATTCA

Gene: BPSL2850: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
*
Burkholderia mallei ATCC 23344

Site:
position = -109
score = 5.31238
sequence = GAAAAACATCTAGACGTATATA

Site:
position = -101
score = 5.31419
sequence = TCTAGACGTATATACGGATTCA

Gene: BMA2407: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -104
score = 5.43962
sequence = TATAGTCGTCTAGACGTTGCGA

Gene: Bxe_B0839: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
*
Burkholderia phymatum STM815

Site:
position = -111
score = 4.65115
sequence = TGCAAAGATATAGTCGTCTAGA

Site:
position = -103
score = 4.90567
sequence = TATAGTCGTCTAGATGTTGCGA

Gene: Bphy_4623: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnD
 
Burkholderia pseudomallei K96243

Gene: BPSL2849: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B0838: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
 
Burkholderia phymatum STM815

Gene: Bphy_4622: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnE
 
Burkholderia pseudomallei K96243

Gene: BPSL2848: Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
 
Burkholderia mallei ATCC 23344

Gene: BMA2409: Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_B0837: Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
 
Burkholderia phymatum STM815

Gene: Bphy_4621: Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD