Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnF - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000
Ralstonia pickettii 12J
Ralstonia metallidurans CH34 11 2
Ralstonia eutropha JMP134 11 2
Ralstonia eutropha H16 10 2
Cupriavidus taiwanensis 10 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnG
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -29
score = 7.02863
sequence = TCTAAACGTATAGACGTATAGG

Gene: Rmet_0766: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Ralstonia eutropha JMP134

Site:
position = -29
score = 6.7315
sequence = TCTACACGTATAGACGTATAGG

Gene: Reut_B4186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Ralstonia eutropha H16

Site:
position = -26
score = 7.02863
sequence = TCTAAACGTATAGACGTATAGG

Gene: H16_B1288: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
*
Cupriavidus taiwanensis

Site:
position = -23
score = 7.02863
sequence = TCTAAACGTATAGACGTATAGG

Gene: RALTA_B1191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0765: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Ralstonia eutropha JMP134

Gene: Reut_B4187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Ralstonia eutropha H16

Gene: H16_B1287: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
 
Cupriavidus taiwanensis

Gene: RALTA_B1190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Ralstonia eutropha JMP134

Gene: Reut_B4188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Ralstonia eutropha H16

Gene: H16_B1286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
 
Cupriavidus taiwanensis

Gene: RALTA_B1189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Ralstonia eutropha JMP134

Gene: Reut_B4189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Ralstonia eutropha H16

Gene: H16_B1285: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
 
Cupriavidus taiwanensis

Gene: RALTA_B1188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Ralstonia eutropha JMP134

Gene: Reut_B4190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Ralstonia eutropha H16

Gene: H16_B1284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
 
Cupriavidus taiwanensis

Gene: RALTA_B1187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Ralstonia eutropha JMP134

Gene: Reut_B4191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Ralstonia eutropha H16

Gene: H16_B1283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
 
Cupriavidus taiwanensis

Gene: RALTA_B1186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnM
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0760: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Ralstonia eutropha JMP134

Gene: Reut_B4192: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Ralstonia eutropha H16

Gene: H16_B1282: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Cupriavidus taiwanensis

Gene: RALTA_B1185: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
CRON 2.
phnF
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -155
score = 7.02863
sequence = CCTATACGTCTATACGTTTAGA

Gene: Rmet_0767: Transcriptional regulator for phosphonate utilization, GntR family
*
Ralstonia eutropha JMP134

Site:
position = -243
score = 6.7315
sequence = CCTATACGTCTATACGTGTAGA

Gene: Reut_B4185: Transcriptional regulator for phosphonate utilization, GntR family
*
Ralstonia eutropha H16

Site:
position = -174
score = 7.02863
sequence = CCTATACGTCTATACGTTTAGA

Gene: H16_B1289: Transcriptional regulator for phosphonate utilization, GntR family
*
Cupriavidus taiwanensis

Site:
position = -174
score = 7.02863
sequence = CCTATACGTCTATACGTTTAGA

Gene: RALTA_B1192: Transcriptional regulator for phosphonate utilization, GntR family
Transcriptional regulator for phosphonate utilization, GntR family
phnM
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_0507: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Ralstonia metallidurans CH34

Gene: Rmet_0768: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Ralstonia eutropha JMP134

Gene: Reut_B4184: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
rcsF
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_0506: Protein RcsF involved in phosphonates utilization
 
Ralstonia metallidurans CH34

Gene: Rmet_0769: Protein RcsF involved in phosphonates utilization
 
Ralstonia eutropha JMP134

Gene: Reut_B4183: Protein RcsF involved in phosphonates utilization
 
Ralstonia eutropha H16

Gene: H16_B1290: Protein RcsF involved in phosphonates utilization
 
Cupriavidus taiwanensis

Gene: RALTA_B1193: Protein RcsF involved in phosphonates utilization
Protein RcsF involved in phosphonates utilization
phnN
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_0770: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Ralstonia eutropha JMP134

Gene: Reut_B4182: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Ralstonia eutropha H16

Gene: H16_B1291: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
 
Cupriavidus taiwanensis

Gene: RALTA_B1194: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD