Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 5 2
Caulobacter segnis ATCC 21756 5 2
Caulobacter sp. K31
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutB
*
Caulobacter crescentus CB15

Site:
position = -137
score = 5.48597
sequence = TCTGGACCATTTGGTCAAAC

Gene: CC2795: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
*
Caulobacter segnis ATCC 21756

Site:
position = -98
score = 5.86934
sequence = TTTGGACCATTTGGTCAAAC

Gene: Cseg_2078: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Caulobacter sp. K31

Gene: Caul_3979: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Phenylobacterium zucineum HLK1
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Caulobacter crescentus CB15

Gene: CC2796: Aminoacrylate peracid reductase
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2079: Aminoacrylate peracid reductase
 
Caulobacter sp. K31

Gene: Caul_3980: Aminoacrylate peracid reductase
 
Phenylobacterium zucineum HLK1
Aminoacrylate peracid reductase
rutD
 
Caulobacter crescentus CB15

Gene: CC2797: Aminoacrylate hydrolase
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2080: Aminoacrylate hydrolase
 
Caulobacter sp. K31

Gene: Caul_3981: Aminoacrylate hydrolase
 
Phenylobacterium zucineum HLK1
Aminoacrylate hydrolase
rutA
 
Caulobacter crescentus CB15

Gene: CC2798: Pyrimidine oxygenase
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2081: Pyrimidine oxygenase
 
Caulobacter sp. K31

Gene: Caul_3982: Pyrimidine oxygenase
 
Phenylobacterium zucineum HLK1
Pyrimidine oxygenase
 
CRON 2.
rutR
*
Caulobacter crescentus CB15

Site:
position = -31
score = 5.74706
sequence = GTTTGACCAAATGGTCCAGA

Gene: CC2794: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Caulobacter segnis ATCC 21756

Site:
position = -31
score = 6.14457
sequence = GTTTGACCAAATGGTCCAAA

Gene: Cseg_2077: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD