Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1 3 1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutA
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -121
score = 5.06331
sequence = GTTTGTGCAAACGGTCAAAT

Site:
position = -88
score = 5.97284
sequence = GTTTGACCAAATGGTCTGAA

Gene: Magn03006049: Pyrimidine oxygenase
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Pyrimidine oxygenase
rutB
 
Rhodospirillum rubrum ATCC 11170
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03006050: Peroxyureidoacrylate / ureidoacrylate amido hydrolase

Gene: Magn03006051: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD