Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 62 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 7 4
Paracoccus denitrificans PD1222 3 1
Jannaschia sp. CCS1 24 5
Rhodobacterales bacterium HTCC2654 14 6
Oceanicola granulosus HTCC2516 14 4
Loktanella vestfoldensis SKA53 12 4
Oceanicola batsensis HTCC2597 5 3
Roseovarius nubinhibens ISM 15 4
Roseovarius sp. 217 14 4
Sulfitobacter sp. EE-36 4 3
Silicibacter TM1040 18 6
Silicibacter pomeroyi DSS-3 22 7
Roseobacter sp. MED193 24 8
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutR
*2
Rhodobacter sphaeroides 2.4.1

Site:
position = -80
score = 4.82796
sequence = GTTTGACCGTCCGGTCAGGA

Gene: RSP_0186: Transcriptional regulator RutR of pyrimidine catabolism, TetR family

Site:
position = -36
score = 4.63164
sequence = ACCTGACCAAGCGGTCAATA

Site:
position = -70
score = 4.82204
sequence = GTTCGACCATCCGGTCAGAT

Gene: RSP_0185: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Paracoccus denitrificans PD1222

Gene: Pden_1121: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Jannaschia sp. CCS1

Site:
position = -177
score = 5.39751
sequence = TTTTGACCAAACGGTCAAGG

Gene: Jann_2710: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Rhodobacterales bacterium HTCC2654

Site:
position = -61
score = 4.91001
sequence = CGTTGATCATCTGGTCAAAT

Gene: RB2654_07801: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Oceanicola granulosus HTCC2516

Site:
position = -92
score = 5.51361
sequence = ATTTGACCAATCGGTTAAAG

Gene: OG2516_10906: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Loktanella vestfoldensis SKA53

Site:
position = -143
score = 5.97014
sequence = GTTTGACCAGATGGTCAAAA

Gene: SKA53_10679: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Oceanicola batsensis HTCC2597

Site:
position = -177
score = 5.87308
sequence = TTTTGACCAATCGGTCAAAG

Gene: OB2597_04330: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Roseovarius nubinhibens ISM

Site:
position = -147
score = 5.99256
sequence = ATTTTACCATTTGGTAAAGT

Gene: ISM_13625: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Roseovarius sp. 217

Site:
position = -58
score = 5.80903
sequence = TTTTTACCATTTGGTAAACT

Gene: ROS217_12316: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Sulfitobacter sp. EE-36

Site:
position = -128
score = 5.71638
sequence = TTTTTACCATTTGGTAAATC

Gene: EE36_09053: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Silicibacter TM1040

Site:
position = -156
score = 6.01887
sequence = ATTTGACCAACTGGTCAAAC

Gene: TM1040_1499: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Silicibacter pomeroyi DSS-3

Site:
position = -119
score = 6.01887
sequence = ATTTGACCAACTGGTCAAAC

Gene: SPO1780: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Roseobacter sp. MED193

Site:
position = -155
score = 6.01887
sequence = ATTTGACCAACTGGTCAAAC

Gene: MED193_05524: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 2.
praX
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -57
score = 5.67797
sequence = CCTTGACCGTTTGGTCAAAA

Gene: Jann_2709: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
Jann_2708
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2708: Hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
pydC
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -121
score = 4.79841
sequence = TATTGACCGCTTGGTCAGGT

Site:
position = -87
score = 4.82363
sequence = ATCTGACCGGATGGTCGAAC

Gene: RSP_0184: Beta-ureidopropionase (EC 3.5.1.6)
*
Paracoccus denitrificans PD1222

Site:
position = -225
score = 5.14572
sequence = TATTGACTGGTTGATAAAAT

Gene: Pden_1113: Beta-ureidopropionase (EC 3.5.1.6)
 
Jannaschia sp. CCS1

Gene: Jann_2707: Beta-ureidopropionase (EC 3.5.1.6)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -233
score = 5.7531
sequence = ATTTAACCGAATGGTAAAAA

Gene: RB2654_14955: Beta-ureidopropionase (EC 3.5.1.6)
*
Oceanicola granulosus HTCC2516

Site:
position = -69
score = 5.61779
sequence = CTTTAACCGATTGGTCAAAT

Gene: OG2516_10901: Beta-ureidopropionase (EC 3.5.1.6)
*
Loktanella vestfoldensis SKA53

Site:
position = -39
score = 5.92449
sequence = TTTTGACCATCTGGTCAAAC

Gene: SKA53_10674: Beta-ureidopropionase (EC 3.5.1.6)
*
Oceanicola batsensis HTCC2597

Site:
position = -43
score = 6.02562
sequence = CTTTGACCGATTGGTCAAAA

Gene: OB2597_04325: Beta-ureidopropionase (EC 3.5.1.6)
*
Roseovarius nubinhibens ISM

Site:
position = -41
score = 5.88633
sequence = ACTTTACCAAATGGTAAAAT

Gene: ISM_13620: Beta-ureidopropionase (EC 3.5.1.6)
*
Roseovarius sp. 217

Site:
position = -33
score = 5.74021
sequence = AGTTTACCAAATGGTAAAAA

Gene: ROS217_12311: Beta-ureidopropionase (EC 3.5.1.6)
*
Sulfitobacter sp. EE-36

Site:
position = -61
score = 5.75672
sequence = GATTTACCAAATGGTAAAAA

Gene: EE36_09058: Beta-ureidopropionase (EC 3.5.1.6)
*
Silicibacter TM1040

Site:
position = -153
score = 6.08052
sequence = GTTTGACCAGTTGGTCAAAT

Gene: TM1040_1498: Beta-ureidopropionase (EC 3.5.1.6)
*
Silicibacter pomeroyi DSS-3

Site:
position = -64
score = 6.08052
sequence = GTTTGACCAGTTGGTCAAAT

Gene: SPO1781: Beta-ureidopropionase (EC 3.5.1.6)
*
Roseobacter sp. MED193

Site:
position = -119
score = 6.08052
sequence = GTTTGACCAGTTGGTCAAAT

Gene: MED193_05519: Beta-ureidopropionase (EC 3.5.1.6)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Beta-ureidopropionase (EC 3.5.1.6)
Jann_2706
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2706: hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
pydB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0183: phenylhydantoinase
 
Paracoccus denitrificans PD1222

Gene: Pden_1112: phenylhydantoinase
 
Jannaschia sp. CCS1

Gene: Jann_2705: phenylhydantoinase
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14925: phenylhydantoinase
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10886: phenylhydantoinase
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10664: phenylhydantoinase
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04303: phenylhydantoinase
 
Roseovarius nubinhibens ISM

Gene: ISM_13615: phenylhydantoinase
 
Roseovarius sp. 217

Gene: ROS217_12306: phenylhydantoinase
 
Sulfitobacter sp. EE-36

Gene: EE36_09070: phenylhydantoinase
 
Silicibacter TM1040

Gene: TM1040_1497: phenylhydantoinase
 
Silicibacter pomeroyi DSS-3

Gene: SPO1783: phenylhydantoinase
 
Roseobacter sp. MED193

Gene: MED193_05514: phenylhydantoinase
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
phenylhydantoinase
Jann_2704
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2704: Hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
pytA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2703: Pyrimidine ABC transporter, ATP-binding protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10876: Pyrimidine ABC transporter, ATP-binding protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10659: Pyrimidine ABC transporter, ATP-binding protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04298: Pyrimidine ABC transporter, ATP-binding protein
 
Roseovarius nubinhibens ISM

Gene: ISM_13605: Pyrimidine ABC transporter, ATP-binding protein
 
Roseovarius sp. 217

Gene: ROS217_12301: Pyrimidine ABC transporter, ATP-binding protein
 
Sulfitobacter sp. EE-36

Gene: EE36_09075: Pyrimidine ABC transporter, ATP-binding protein
 
Silicibacter TM1040

Gene: TM1040_1496: Pyrimidine ABC transporter, ATP-binding protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO1785: Pyrimidine ABC transporter, ATP-binding protein
 
Roseobacter sp. MED193

Gene: MED193_05509: Pyrimidine ABC transporter, ATP-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyrimidine ABC transporter, ATP-binding protein
Jann_2702
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2702: Predicted N-acetyltransferase
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted N-acetyltransferase
pytB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0181: Pyrimidine ABC transporter, permease protein 1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2701: Pyrimidine ABC transporter, permease protein 1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14885: Pyrimidine ABC transporter, permease protein 1
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10871: Pyrimidine ABC transporter, permease protein 1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10654: Pyrimidine ABC transporter, permease protein 1
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04293: Pyrimidine ABC transporter, permease protein 1
 
Roseovarius nubinhibens ISM

Gene: ISM_13600: Pyrimidine ABC transporter, permease protein 1
 
Roseovarius sp. 217

Gene: ROS217_12296: Pyrimidine ABC transporter, permease protein 1
 
Sulfitobacter sp. EE-36

Gene: EE36_09080: Pyrimidine ABC transporter, permease protein 1
 
Silicibacter TM1040

Gene: TM1040_1495: Pyrimidine ABC transporter, permease protein 1
 
Silicibacter pomeroyi DSS-3

Gene: SPO1786: Pyrimidine ABC transporter, permease protein 1
 
Roseobacter sp. MED193

Gene: MED193_05499: Pyrimidine ABC transporter, permease protein 1
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyrimidine ABC transporter, permease protein 1
pytC
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0180: Pyrimidine ABC transporter, permease protein 2
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2700: Pyrimidine ABC transporter, permease protein 2
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14880: Pyrimidine ABC transporter, permease protein 2
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10866: Pyrimidine ABC transporter, permease protein 2
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10649: Pyrimidine ABC transporter, permease protein 2
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04288: Pyrimidine ABC transporter, permease protein 2
 
Roseovarius nubinhibens ISM

Gene: ISM_13595: Pyrimidine ABC transporter, permease protein 2
 
Roseovarius sp. 217

Gene: ROS217_12291: Pyrimidine ABC transporter, permease protein 2
 
Sulfitobacter sp. EE-36

Gene: EE36_09085: Pyrimidine ABC transporter, permease protein 2
 
Silicibacter TM1040

Gene: TM1040_1494: Pyrimidine ABC transporter, permease protein 2
 
Silicibacter pomeroyi DSS-3

Gene: SPO1787: Pyrimidine ABC transporter, permease protein 2
 
Roseobacter sp. MED193

Gene: MED193_05489: Pyrimidine ABC transporter, permease protein 2
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyrimidine ABC transporter, permease protein 2
pytD
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0179: Pyrimidine ABC transporter, substrate-binding protein
 
Paracoccus denitrificans PD1222

Gene: Pden_4039: Pyrimidine ABC transporter, substrate-binding protein
 
Jannaschia sp. CCS1

Gene: Jann_2699: Pyrimidine ABC transporter, substrate-binding protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14870: Pyrimidine ABC transporter, substrate-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10861: Pyrimidine ABC transporter, substrate-binding protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10644: Pyrimidine ABC transporter, substrate-binding protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04283: Pyrimidine ABC transporter, substrate-binding protein
 
Roseovarius nubinhibens ISM

Gene: ISM_13590: Pyrimidine ABC transporter, substrate-binding protein
 
Roseovarius sp. 217

Gene: ROS217_12286: Pyrimidine ABC transporter, substrate-binding protein
 
Sulfitobacter sp. EE-36

Gene: EE36_09090: Pyrimidine ABC transporter, substrate-binding protein
 
Silicibacter TM1040

Gene: TM1040_1493: Pyrimidine ABC transporter, substrate-binding protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO1788: Pyrimidine ABC transporter, substrate-binding protein
*
Roseobacter sp. MED193

Site:
position = -60
score = 5.14316
sequence = ATTTGATCGAAGGGTCAAAT

Gene: MED193_05484: Pyrimidine ABC transporter, substrate-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyrimidine ABC transporter, substrate-binding protein
OG2516_10896
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10896: Hypothetical protein
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
OG2516_10891
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10891: N-carbamoyl-L-amino acid amidohydrolase
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
N-carbamoyl-L-amino acid amidohydrolase
RSP_1242
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1242: Predicted lyase
 
Paracoccus denitrificans PD1222

Gene: Pden_3947: Predicted lyase
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14915: Predicted lyase
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10881: Predicted lyase
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_01147: Predicted lyase
 
Roseovarius nubinhibens ISM

Gene: ISM_13610: Predicted lyase
 
Roseovarius sp. 217

Gene: ROS217_21982: Predicted lyase
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted lyase
SKA53_10669
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10669: Hypothetical protein
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
MED193_05504
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_05504: Hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
MED193_05494
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_05494: Hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
pydP
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_1111: Pyrimidine permease in reductive pathway
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyrimidine permease in reductive pathway
RB2654_14945
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO1782: Hypothetical protein
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
 
CRON 3.
pydX
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -74
score = 5.38228
sequence = TATTTATCGTTTGGTAAAAA

Gene: RSP_0189: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -76
score = 5.76894
sequence = ATTTTACCATTTGATAAATT

Gene: Jann_2713: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*2
Rhodobacterales bacterium HTCC2654

Site:
position = -337
score = 6.14879
sequence = TTTTTACCAATTGATAAAAA

Gene: RB2654_14990: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism

Gene: RB2654_14980: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Oceanicola granulosus HTCC2516

Site:
position = -62
score = 6.02039
sequence = ATTTTACCGTTTGATAAAAT

Gene: OG2516_10926: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Loktanella vestfoldensis SKA53

Site:
position = -67
score = 5.76987
sequence = AATTTACCGTTTGATAAAAA

Gene: SKA53_10689: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Oceanicola batsensis HTCC2597

Site:
position = -66
score = 5.92024
sequence = AATTTACCATTTGATAAAAA

Gene: OB2597_04355: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Roseovarius nubinhibens ISM

Site:
position = -75
score = 6.19266
sequence = ATTTTACCAATTGATAAAAT

Gene: ISM_13640: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Roseovarius sp. 217

Site:
position = -69
score = 6.19266
sequence = ATTTTACCAATTGATAAAAT

Gene: ROS217_06720: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Sulfitobacter sp. EE-36

Site:
position = -72
score = 6.10778
sequence = ATTTTACCAGTTGATAAAAA

Gene: EE36_09043: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Silicibacter TM1040

Site:
position = -91
score = 6.10778
sequence = ATTTTACCAGTTGATAAAAA

Gene: TM1040_1501: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Silicibacter pomeroyi DSS-3

Site:
position = -89
score = 5.12353
sequence = TTTTGACCGAAAGATAAATT

Site:
position = -72
score = 6.07918
sequence = ATTTTACCAGTTGATAAAAT

Gene: SPO1776: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Roseobacter sp. MED193

Site:
position = -74
score = 6.10778
sequence = ATTTTACCAGTTGATAAAAA

Gene: MED193_05534: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
OB2597_04350
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04350: Hypothetical protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
pydA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0187: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2712: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14975: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_10921: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10684: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_04345: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Roseovarius nubinhibens ISM

Gene: ISM_13635: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Roseovarius sp. 217

Gene: ROS217_06715: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Sulfitobacter sp. EE-36

Gene: EE36_09048: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Silicibacter TM1040

Gene: TM1040_1500: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Silicibacter pomeroyi DSS-3

Gene: SPO1777: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Roseobacter sp. MED193

Gene: MED193_05529: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
RSP_0188
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0188: DedA family integral membrane protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
DedA family integral membrane protein
 
CRON 4.
deoC
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3739: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Paracoccus denitrificans PD1222

Gene: Pden_3897: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Jannaschia sp. CCS1

Site:
position = -65
score = 5.56797
sequence = TTTTGACCGTTTGGTCAACC

Gene: Jann_0789: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -26
score = 5.43309
sequence = ATTTGACCAAAAGGAAAAAT

Gene: RB2654_10383: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Oceanicola granulosus HTCC2516

Site:
position = -75
score = 5.88201
sequence = TTTTTACCGGTTGGTCAAAC

Gene: OG2516_07892: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Loktanella vestfoldensis SKA53

Site:
position = -59
score = 6.22261
sequence = GTTTGACCAATTGGTCAAAA

Gene: SKA53_09929: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_13563: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_05768: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Silicibacter TM1040

Site:
position = -105
score = 5.41785
sequence = TTTTGTCCTTTTGGTAAAAA

Gene: TM1040_0097: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Silicibacter pomeroyi DSS-3

Site:
position = -262
score = 5.25908
sequence = TTTTGTCCGAAAGGTAAAAT

Gene: SPO3367: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
*
Roseobacter sp. MED193

Site:
position = -105
score = 5.48769
sequence = ATTTGTCCAAAAGGTCAAAT

Gene: MED193_12973: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Deoxyribose-phosphate aldolase (EC 4.1.2.4)
Jann_0788
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_0788: Hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
Jann_0787
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_0787: Hypothetical protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical protein
ald
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3740: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Paracoccus denitrificans PD1222

Gene: Pden_3898: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Jannaschia sp. CCS1

Gene: Jann_0786: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_10378: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07897: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09934: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_13558: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_05773: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Silicibacter TM1040

Gene: TM1040_0096: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3368: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Roseobacter sp. MED193

Gene: MED193_12978: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Aldehyde dehydrogenase (EC 1.2.1.3)
 
CRON 5.
codA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0341: Cytosine deaminase (EC 3.5.4.1)
 
Paracoccus denitrificans PD1222
*
Jannaschia sp. CCS1

Site:
position = -36
score = 5.45752
sequence = ATTTTACCATATGGTAAGGA

Gene: Jann_1306: Cytosine deaminase (EC 3.5.4.1)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_11230: Cytosine deaminase (EC 3.5.4.1)
 
Roseovarius sp. 217

Gene: ROS217_10957: Cytosine deaminase (EC 3.5.4.1)
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2806: Cytosine deaminase (EC 3.5.4.1)
 
Roseobacter sp. MED193

Gene: MED193_17224: Cytosine deaminase (EC 3.5.4.1)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Cytosine deaminase (EC 3.5.4.1)
pytM
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0345: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1305: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -53
score = 5.78057
sequence = TCTTTACCGTTTGGTAAAAT

Gene: ISM_11210: Predicted pyrimidine ABC transporter, substrate-binding protein
*
Roseovarius sp. 217

Site:
position = -44
score = 6.21258
sequence = ATTTTACCAATTGGTAAAAC

Gene: ROS217_10977: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = 11
score = 4.96185
sequence = AATTGACTGCTCGGTAAAAA

Gene: SPO2802: Predicted pyrimidine ABC transporter, substrate-binding protein
*
Roseobacter sp. MED193

Site:
position = 74
score = 4.99615
sequence = TTTTTACCCTTTGGACAAGA

Gene: MED193_17244: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted pyrimidine ABC transporter, substrate-binding protein
amiC
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1304: Predicted amidase
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted amidase
pytN
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0344: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1303: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_11215: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Roseovarius sp. 217

Gene: ROS217_10972: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2803: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Roseobacter sp. MED193

Gene: MED193_17239: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted pyrimidine ABC transporter, ATP-binding protein
pytO
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0343: Predicted pyrimidine ABC transporter, permease protein 1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1302: Predicted pyrimidine ABC transporter, permease protein 1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_11220: Predicted pyrimidine ABC transporter, permease protein 1
 
Roseovarius sp. 217

Gene: ROS217_10967: Predicted pyrimidine ABC transporter, permease protein 1
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2804: Predicted pyrimidine ABC transporter, permease protein 1
 
Roseobacter sp. MED193

Gene: MED193_17234: Predicted pyrimidine ABC transporter, permease protein 1
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted pyrimidine ABC transporter, permease protein 1
pytQ
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0342: Predicted pyrimidine ABC transporter, permease protein 2
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_1301: Predicted pyrimidine ABC transporter, permease protein 2
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_11225: Predicted pyrimidine ABC transporter, permease protein 2
 
Roseovarius sp. 217

Gene: ROS217_10962: Predicted pyrimidine ABC transporter, permease protein 2
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2805: Predicted pyrimidine ABC transporter, permease protein 2
 
Roseobacter sp. MED193

Gene: MED193_17229: Predicted pyrimidine ABC transporter, permease protein 2
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted pyrimidine ABC transporter, permease protein 2
 
CRON 6.
cdd
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1594: Cytidine deaminase (EC 3.5.4.5)
 
Paracoccus denitrificans PD1222

Gene: Pden_2223: Cytidine deaminase (EC 3.5.4.5)
 
Jannaschia sp. CCS1

Gene: Jann_2987: Cytidine deaminase (EC 3.5.4.5)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -29
score = 5.04047
sequence = ACTGGACCATACGGTCAAAG

Gene: RB2654_20823: Cytidine deaminase (EC 3.5.4.5)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13469: Cytidine deaminase (EC 3.5.4.5)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09379: Cytidine deaminase (EC 3.5.4.5)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06345: Cytidine deaminase (EC 3.5.4.5)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_03708: Cytidine deaminase (EC 3.5.4.5)
*
Silicibacter TM1040

Site:
position = -52
score = 5.78603
sequence = ATTTGACCATCCGATCAAAA

Gene: TM1040_1572: Cytidine deaminase (EC 3.5.4.5)
*
Silicibacter pomeroyi DSS-3

Site:
position = -34
score = 5.09406
sequence = TTCCGACCAGATGATCAAAA

Gene: SPO2930: Cytidine deaminase (EC 3.5.4.5)
 
Roseobacter sp. MED193

Gene: MED193_06044: Cytidine deaminase (EC 3.5.4.5)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1295: Cytidine deaminase (EC 3.5.4.5)
 
Oceanicaulis alexandrii HTCC2633
Cytidine deaminase (EC 3.5.4.5)
deoA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1595: Thymidine phosphorylase (EC 2.4.2.4)
 
Paracoccus denitrificans PD1222

Gene: Pden_2222: Thymidine phosphorylase (EC 2.4.2.4)
 
Jannaschia sp. CCS1

Gene: Jann_2986: Thymidine phosphorylase (EC 2.4.2.4)
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13474: Thymidine phosphorylase (EC 2.4.2.4)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09374: Thymidine phosphorylase (EC 2.4.2.4)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06340: Thymidine phosphorylase (EC 2.4.2.4)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_03703: Thymidine phosphorylase (EC 2.4.2.4)
 
Silicibacter TM1040

Gene: TM1040_1571: Thymidine phosphorylase (EC 2.4.2.4)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2929: Thymidine phosphorylase (EC 2.4.2.4)
 
Roseobacter sp. MED193

Gene: MED193_06039: Thymidine phosphorylase (EC 2.4.2.4)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Thymidine phosphorylase (EC 2.4.2.4)
deoB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1596: Phosphopentomutase (EC 5.4.2.7)
 
Paracoccus denitrificans PD1222

Gene: Pden_2221: Phosphopentomutase (EC 5.4.2.7)
 
Jannaschia sp. CCS1

Gene: Jann_2985: Phosphopentomutase (EC 5.4.2.7)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20828: Phosphopentomutase (EC 5.4.2.7)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13479: Phosphopentomutase (EC 5.4.2.7)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09369: Phosphopentomutase (EC 5.4.2.7)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06335: Phosphopentomutase (EC 5.4.2.7)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_03698: Phosphopentomutase (EC 5.4.2.7)
 
Silicibacter TM1040

Gene: TM1040_1570: Phosphopentomutase (EC 5.4.2.7)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2928: Phosphopentomutase (EC 5.4.2.7)
 
Roseobacter sp. MED193

Gene: MED193_06034: Phosphopentomutase (EC 5.4.2.7)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Phosphopentomutase (EC 5.4.2.7)
add
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1597: Adenosine deaminase (EC 3.5.4.4)
 
Paracoccus denitrificans PD1222

Gene: Pden_2220: Adenosine deaminase (EC 3.5.4.4)
 
Jannaschia sp. CCS1

Gene: Jann_2984: Adenosine deaminase (EC 3.5.4.4)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20833: Adenosine deaminase (EC 3.5.4.4)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13484: Adenosine deaminase (EC 3.5.4.4)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09364: Adenosine deaminase (EC 3.5.4.4)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06330: Adenosine deaminase (EC 3.5.4.4)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO2927: Adenosine deaminase (EC 3.5.4.4)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Adenosine deaminase (EC 3.5.4.4)
upp
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1598: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Paracoccus denitrificans PD1222

Gene: Pden_2219: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Jannaschia sp. CCS1

Gene: Jann_2983: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20838: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13489: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_09359: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06325: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Roseovarius nubinhibens ISM

Gene: ISM_09591: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Roseovarius sp. 217

Gene: ROS217_16770: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Sulfitobacter sp. EE-36

Gene: EE36_03693: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Silicibacter TM1040

Gene: TM1040_1569: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2926: Uracil phosphoribosyltransferase (EC 2.4.2.9)
*
Roseobacter sp. MED193

Site:
position = -97
score = 5.40669
sequence = CTTTGACCATCAGATCAAAA

Gene: MED193_06029: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
CRON 7.
pntD
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2211: Predicted nucleoside ABC transporter, substrate-binding protein
 
Paracoccus denitrificans PD1222

Gene: Pden_0528: Predicted nucleoside ABC transporter, substrate-binding protein
 
Jannaschia sp. CCS1

Gene: Jann_0861: Predicted nucleoside ABC transporter, substrate-binding protein
*
Rhodobacterales bacterium HTCC2654

Site:
position = -186
score = 4.77753
sequence = TTTTGAACGTCGGGTCAAAT

Gene: RB2654_20923: Predicted nucleoside ABC transporter, substrate-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07982: Predicted nucleoside ABC transporter, substrate-binding protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14686: Predicted nucleoside ABC transporter, substrate-binding protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_10104: Predicted nucleoside ABC transporter, substrate-binding protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_09495: Predicted nucleoside ABC transporter, substrate-binding protein
*
Silicibacter TM1040

Site:
position = -122
score = 5.2166
sequence = TTTAGACCGGCTGGTCAAAA

Gene: TM1040_3094: Predicted nucleoside ABC transporter, substrate-binding protein
*
Silicibacter pomeroyi DSS-3

Site:
position = -142
score = 5.13023
sequence = CTCGGACCATTCGGTCAAAA

Gene: SPO0379: Predicted nucleoside ABC transporter, substrate-binding protein
*
Roseobacter sp. MED193

Site:
position = -154
score = 4.74924
sequence = TTCGCACCAAACGGTCAAAA

Gene: MED193_10378: Predicted nucleoside ABC transporter, substrate-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted nucleoside ABC transporter, substrate-binding protein
OG2516_07987
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07987: Conserved hypothetical protein
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_10383: Conserved hypothetical protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Conserved hypothetical protein
pntA
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2210: Predicted nucleoside ABC transporter, ATP-binding protein
 
Paracoccus denitrificans PD1222

Gene: Pden_0527: Predicted nucleoside ABC transporter, ATP-binding protein
 
Jannaschia sp. CCS1

Gene: Jann_0860: Predicted nucleoside ABC transporter, ATP-binding protein
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20928: Predicted nucleoside ABC transporter, ATP-binding protein
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07992: Predicted nucleoside ABC transporter, ATP-binding protein
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14681: Predicted nucleoside ABC transporter, ATP-binding protein
 
Oceanicola batsensis HTCC2597

Gene: OB2597_10109: Predicted nucleoside ABC transporter, ATP-binding protein
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_09490: Predicted nucleoside ABC transporter, ATP-binding protein
 
Silicibacter TM1040

Gene: TM1040_3095: Predicted nucleoside ABC transporter, ATP-binding protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO0378: Predicted nucleoside ABC transporter, ATP-binding protein
 
Roseobacter sp. MED193

Gene: MED193_10388: Predicted nucleoside ABC transporter, ATP-binding protein
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted nucleoside ABC transporter, ATP-binding protein
pntB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2209: Predicted nucleoside ABC transporter, permease protein 1
 
Paracoccus denitrificans PD1222

Gene: Pden_0526: Predicted nucleoside ABC transporter, permease protein 1
 
Jannaschia sp. CCS1

Gene: Jann_0859: Predicted nucleoside ABC transporter, permease protein 1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20933: Predicted nucleoside ABC transporter, permease protein 1
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07997: Predicted nucleoside ABC transporter, permease protein 1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14676: Predicted nucleoside ABC transporter, permease protein 1
 
Oceanicola batsensis HTCC2597

Gene: OB2597_10114: Predicted nucleoside ABC transporter, permease protein 1
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_09485: Predicted nucleoside ABC transporter, permease protein 1
 
Silicibacter TM1040

Gene: TM1040_3096: Predicted nucleoside ABC transporter, permease protein 1
 
Silicibacter pomeroyi DSS-3

Gene: SPO0377: Predicted nucleoside ABC transporter, permease protein 1
 
Roseobacter sp. MED193

Gene: MED193_10393: Predicted nucleoside ABC transporter, permease protein 1
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted nucleoside ABC transporter, permease protein 1
pntC
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2208: Predicted nucleoside ABC transporter, permease protein 2
 
Paracoccus denitrificans PD1222

Gene: Pden_0525: Predicted nucleoside ABC transporter, permease protein 2
 
Jannaschia sp. CCS1

Gene: Jann_0856: Predicted nucleoside ABC transporter, permease protein 2
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20938: Predicted nucleoside ABC transporter, permease protein 2
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08002: Predicted nucleoside ABC transporter, permease protein 2
 
Loktanella vestfoldensis SKA53

Gene: SKA53_14666: Predicted nucleoside ABC transporter, permease protein 2
 
Oceanicola batsensis HTCC2597

Gene: OB2597_10119: Predicted nucleoside ABC transporter, permease protein 2
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36

Gene: EE36_09480: Predicted nucleoside ABC transporter, permease protein 2
 
Silicibacter TM1040

Gene: TM1040_3097: Predicted nucleoside ABC transporter, permease protein 2
 
Silicibacter pomeroyi DSS-3

Gene: SPO0376: Predicted nucleoside ABC transporter, permease protein 2
 
Roseobacter sp. MED193

Gene: MED193_10398: Predicted nucleoside ABC transporter, permease protein 2
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Predicted nucleoside ABC transporter, permease protein 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD