Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 18 6
Rhizobium sp. NGR234 16 6
Rhizobium leguminosarum bv. viciae 3841 20 5
Rhizobium etli CFN 42 20 5
Agrobacterium tumefaciens str. C58 (Cereon) 23 5
Mesorhizobium sp. BNC1 16 4
Mesorhizobium loti MAFF303099 18 6
Brucella melitensis 16M 6 3
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 9 3
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pydC
*
Sinorhizobium meliloti 1021

Site:
position = -145
score = 5.51835
sequence = TGTTTACCAACCGGTCAAAT

Gene: SMc01820: Beta-ureidopropionase (EC 3.5.1.6)
*
Rhizobium sp. NGR234

Site:
position = -147
score = 5.51835
sequence = TGTTTACCAACCGGTCAAAT

Gene: NGR_c24830: Beta-ureidopropionase (EC 3.5.1.6)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -159
score = 5.58419
sequence = TGTTTACCAATCGGTCAAAT

Gene: RL3716: Beta-ureidopropionase (EC 3.5.1.6)
*
Rhizobium etli CFN 42

Site:
position = -156
score = 5.58419
sequence = TGTTTACCAATCGGTCAAAT

Gene: RHE_CH03290: Beta-ureidopropionase (EC 3.5.1.6)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -145
score = 5.19787
sequence = TGTTTACCAGCCGGTCAATT

Gene: Atu2385: Beta-ureidopropionase (EC 3.5.1.6)
 
Mesorhizobium sp. BNC1

Gene: Meso_2043: Beta-ureidopropionase (EC 3.5.1.6)
 
Mesorhizobium loti MAFF303099

Gene: mll1631: Beta-ureidopropionase (EC 3.5.1.6)
*
Brucella melitensis 16M

Site:
position = -148
score = 5.09773
sequence = TTTTGACCAACTAGTCAAGT

Gene: BMEI1643: Beta-ureidopropionase (EC 3.5.1.6)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6028: Beta-ureidopropionase (EC 3.5.1.6)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Beta-ureidopropionase (EC 3.5.1.6)
pydB
 
Sinorhizobium meliloti 1021

Gene: SMc01821: Dihydropyrimidinase (EC 3.5.2.2)
 
Rhizobium sp. NGR234

Gene: NGR_c24840: Dihydropyrimidinase (EC 3.5.2.2)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3718: Dihydropyrimidinase (EC 3.5.2.2)
 
Rhizobium etli CFN 42

Gene: RHE_CH03292: Dihydropyrimidinase (EC 3.5.2.2)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2386: Dihydropyrimidinase (EC 3.5.2.2)
 
Mesorhizobium sp. BNC1

Gene: Meso_2664: Dihydropyrimidinase (EC 3.5.2.2)
 
Mesorhizobium loti MAFF303099

Gene: mll1629: Dihydropyrimidinase (EC 3.5.2.2)
 
Brucella melitensis 16M

Gene: BMEI1644: Dihydropyrimidinase (EC 3.5.2.2)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: blr7615: Dihydropyrimidinase (EC 3.5.2.2)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6029: Dihydropyrimidinase (EC 3.5.2.2)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Dihydropyrimidinase (EC 3.5.2.2)
Atu2387
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2387: NTP pyrophosphohydrolase, MutT family
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
NTP pyrophosphohydrolase, MutT family
pytA
 
Sinorhizobium meliloti 1021

Gene: SMc01823: Pyrimidine ABC transporter ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c24860: Pyrimidine ABC transporter ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3720: Pyrimidine ABC transporter ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03294: Pyrimidine ABC transporter ATP-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2388: Pyrimidine ABC transporter ATP-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2044: Pyrimidine ABC transporter ATP-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mll1625: Pyrimidine ABC transporter ATP-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -136
score = 5.05638
sequence = ATCTGATCAAATGGTCAAAT

Gene: BBta_6033: Pyrimidine ABC transporter ATP-binding protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Pyrimidine ABC transporter ATP-binding protein
pytB
 
Sinorhizobium meliloti 1021

Gene: SMc01825: Pyrimidine ABC transporter, permease protein 1
 
Rhizobium sp. NGR234

Gene: NGR_c24870: Pyrimidine ABC transporter, permease protein 1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3721: Pyrimidine ABC transporter, permease protein 1
 
Rhizobium etli CFN 42

Gene: RHE_CH03295: Pyrimidine ABC transporter, permease protein 1
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2389: Pyrimidine ABC transporter, permease protein 1
 
Mesorhizobium sp. BNC1

Gene: Meso_2045: Pyrimidine ABC transporter, permease protein 1
 
Mesorhizobium loti MAFF303099

Gene: mll1624: Pyrimidine ABC transporter, permease protein 1
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6032: Pyrimidine ABC transporter, permease protein 1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Pyrimidine ABC transporter, permease protein 1
pytC
 
Sinorhizobium meliloti 1021

Gene: SMc01826: Pyrimidine ABC transporter, permease protein 2
 
Rhizobium sp. NGR234

Gene: NGR_c24880: Pyrimidine ABC transporter, permease protein 2
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3722: Pyrimidine ABC transporter, permease protein 2
 
Rhizobium etli CFN 42

Gene: RHE_CH03296: Pyrimidine ABC transporter, permease protein 2
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2390: Pyrimidine ABC transporter, permease protein 2
 
Mesorhizobium sp. BNC1

Gene: Meso_2046: Pyrimidine ABC transporter, permease protein 2
 
Mesorhizobium loti MAFF303099

Gene: mll1623: Pyrimidine ABC transporter, permease protein 2
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 2
Bradyrhizobium japonicum USDA 110

Gene: bll3315: Pyrimidine ABC transporter, permease protein 2

Gene: bll3314: Pyrimidine ABC transporter, permease protein 2
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6031: Pyrimidine ABC transporter, permease protein 2
 
Nitrobacter winogradskyi Nb-255
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_2449: Pyrimidine ABC transporter, permease protein 2

Gene: AZC_2448: Pyrimidine ABC transporter, permease protein 2
 
Xanthobacter autotrophicus Py2
Pyrimidine ABC transporter, permease protein 2
pytD
 
Sinorhizobium meliloti 1021

Gene: SMc01827: Pyrimidine ABC transporter, substrate-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c24890: Pyrimidine ABC transporter, substrate-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3723: Pyrimidine ABC transporter, substrate-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03297: Pyrimidine ABC transporter, substrate-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2391: Pyrimidine ABC transporter, substrate-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2047: Pyrimidine ABC transporter, substrate-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mll1621: Pyrimidine ABC transporter, substrate-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll3316: Pyrimidine ABC transporter, substrate-binding protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6030: Pyrimidine ABC transporter, substrate-binding protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2447: Pyrimidine ABC transporter, substrate-binding protein
 
Xanthobacter autotrophicus Py2
Pyrimidine ABC transporter, substrate-binding protein
praX
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -88
score = 4.94419
sequence = GATTGTCCAAACGGTCAAAA

Gene: Meso_2042: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
*
Mesorhizobium loti MAFF303099

Site:
position = -96
score = 5.33527
sequence = GTTTGTCCAATCGGTCAAAA

Gene: mll1632: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
RL3717
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3717: Hypothetical protein
 
Rhizobium etli CFN 42

Gene: RHE_CH03291: Hypothetical protein
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical protein
 
CRON 2.
pytM
*
Sinorhizobium meliloti 1021

Site:
position = -34
score = 5.47743
sequence = ATTCTACCAATCGGTAAAAA

Gene: SMa2361: Predicted pyrimidine ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -62
score = 5.34277
sequence = CATTGACCAAGTGGTAAAAA

Gene: NGR_b02360: Predicted pyrimidine ABC transporter, substrate-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -33
score = 5.3326
sequence = TTTGAACCAAATGGTAAAAA

Gene: pRL90203: Predicted pyrimidine ABC transporter, substrate-binding protein
*
Rhizobium etli CFN 42

Site:
position = -32
score = 5.18993
sequence = TTTGAACCAGATGGTAAAAA

Gene: RHE_PB00102: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -99
score = 5.5084
sequence = ATTTGACCATGTGGACAAAA

Gene: mll4178: Predicted pyrimidine ABC transporter, substrate-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted pyrimidine ABC transporter, substrate-binding protein
pytH
 
Sinorhizobium meliloti 1021

Gene: SMa2363: Predicted hydrolase
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90204: Predicted hydrolase
 
Rhizobium etli CFN 42

Gene: RHE_PB00103: Predicted hydrolase
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted hydrolase
pytN
 
Sinorhizobium meliloti 1021

Gene: SMa2365: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b02350: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90205: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_PB00104: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll4176: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3200: Predicted pyrimidine ABC transporter, ATP-binding protein
 
Xanthobacter autotrophicus Py2
Predicted pyrimidine ABC transporter, ATP-binding protein
pytO
 
Sinorhizobium meliloti 1021

Gene: SMa2367: Predicted pyrimidine ABC transporter, permease protein 1
 
Rhizobium sp. NGR234

Gene: NGR_b02340: Predicted pyrimidine ABC transporter, permease protein 1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90206: Predicted pyrimidine ABC transporter, permease protein 1
 
Rhizobium etli CFN 42

Gene: RHE_PB00105: Predicted pyrimidine ABC transporter, permease protein 1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll4175: Predicted pyrimidine ABC transporter, permease protein 1
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted pyrimidine ABC transporter, permease protein 1
pytQ
 
Sinorhizobium meliloti 1021

Gene: SMa2369: Predicted pyrimidine ABC transporter, permease protein 2
 
Rhizobium sp. NGR234

Gene: NGR_b02330: Predicted pyrimidine ABC transporter, permease protein 2
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90207: Predicted pyrimidine ABC transporter, permease protein 2
 
Rhizobium etli CFN 42

Gene: RHE_PB00106: Predicted pyrimidine ABC transporter, permease protein 2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll4174: Predicted pyrimidine ABC transporter, permease protein 2
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted pyrimidine ABC transporter, permease protein 2
codA
 
Sinorhizobium meliloti 1021

Gene: SMa2371: Cytosine deaminase (EC 3.5.4.1)
 
Rhizobium sp. NGR234

Gene: NGR_b17150: Cytosine deaminase (EC 3.5.4.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90208: Cytosine deaminase (EC 3.5.4.1)
 
Rhizobium etli CFN 42

Gene: RHE_PB00107: Cytosine deaminase (EC 3.5.4.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mlr5363: Cytosine deaminase (EC 3.5.4.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll7276: Cytosine deaminase (EC 3.5.4.1)
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Cytosine deaminase (EC 3.5.4.1)
 
CRON 3.
rutA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -101
score = 5.21616
sequence = TTTTATCCATTTGATAAAAT

Site:
position = -157
score = 5.91029
sequence = TTTTTACCAAATGATAAAAA

Gene: Atu2500: Pyrimidine oxygenase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1128: Pyrimidine oxygenase
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Pyrimidine oxygenase
rutB
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2499: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2493: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Xanthobacter autotrophicus Py2
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2498: Aminoacrylate peracid reductase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3591: Aminoacrylate peracid reductase
 
Bradyrhizobium japonicum USDA 110

Gene: blr6667: Aminoacrylate peracid reductase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6227: Aminoacrylate peracid reductase
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2494: Aminoacrylate peracid reductase
 
Xanthobacter autotrophicus Py2
Aminoacrylate peracid reductase
rutD
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2497: Aminoacrylate hydrolase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2496: Aminoacrylate hydrolase
 
Xanthobacter autotrophicus Py2
Aminoacrylate hydrolase
rutE
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2496: 3-hydroxy propionic acid dehydrogenase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4285: 3-hydroxy propionic acid dehydrogenase
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
3-hydroxy propionic acid dehydrogenase
rutF
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2495: Flavin reductase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Flavin reductase
 
CRON 4.
hpt
 
Sinorhizobium meliloti 1021

Gene: SMc00719: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Rhizobium sp. NGR234

Gene: NGR_c26990: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4328: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Rhizobium etli CFN 42

Gene: RHE_CH03800: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -46
score = 5.0907
sequence = TTTTTACTGAAAGGTAAAAT

Gene: Atu3604: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Mesorhizobium sp. BNC1

Gene: Meso_3093: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Mesorhizobium loti MAFF303099

Gene: mll3520: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Brucella melitensis 16M

Gene: BMEI0082: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4610: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0023: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
CRON 5.
rutR
*
Sinorhizobium meliloti 1021

Site:
position = -153
score = 5.73512
sequence = ATTTGACCGGTTGGTAAACA

Gene: SMc01819: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Rhizobium sp. NGR234

Site:
position = -153
score = 5.73512
sequence = ATTTGACCGGTTGGTAAACA

Gene: NGR_c24820: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -162
score = 5.87779
sequence = ATTTGACCGATTGGTAAACA

Gene: RL3715: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Rhizobium etli CFN 42

Site:
position = -163
score = 5.87779
sequence = ATTTGACCGATTGGTAAACA

Gene: RHE_CH03289: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -153
score = 5.40023
sequence = AATTGACCGGCTGGTAAACA

Gene: Atu2384: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Mesorhizobium sp. BNC1

Site:
position = -130
score = 5.1891
sequence = TTTTGACCGTTTGGACAATC

Gene: Meso_2041: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Mesorhizobium loti MAFF303099

Site:
position = -151
score = 5.48877
sequence = TTTTGACCGATTGGACAAAC

Gene: mlr1634: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*2
Brucella melitensis 16M

Site:
position = -90
score = 5.31183
sequence = ACTTGACTAGTTGGTCAAAA

Gene: BMEI1642: Transcriptional regulator RutR of pyrimidine catabolism, TetR family

Gene: BMEI1641: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -81
score = 5.35908
sequence = ATTTGACCATTTGATCAGAT

Gene: BBta_6034: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 6.
pydX
*
Sinorhizobium meliloti 1021

Site:
position = -71
score = 5.82174
sequence = ATTTTACCGTTTGATAAAAA

Gene: SMc01814: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Rhizobium sp. NGR234

Site:
position = -70
score = 5.82174
sequence = ATTTTACCGTTTGATAAAAA

Gene: NGR_c24760: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -78
score = 5.60247
sequence = ATTTTACCGTTTGATAAATT

Gene: RL3707: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Rhizobium etli CFN 42

Site:
position = -77
score = 5.60247
sequence = ATTTTACCGTTTGATAAATT

Gene: RHE_CH03277: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -64
score = 5.56095
sequence = ATTTGACTGATTGATAAAAA

Gene: Meso_2057: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Mesorhizobium loti MAFF303099

Site:
position = -68
score = 5.81602
sequence = AATTGACCAATTGATAAAAA

Gene: mll1646: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
*
Brucella melitensis 16M

Site:
position = -158
score = 5.4513
sequence = AATTGACCGGATGATAAAAA

Gene: BMEI1638: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -82
score = 5.60495
sequence = TTTTGATCAACTGGTCAAAT

Gene: BBta_6036: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
mll1644
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099

Gene: mll1644: Predicted methyltransferase
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted methyltransferase
pydA
 
Sinorhizobium meliloti 1021

Gene: SMc01815: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Rhizobium sp. NGR234

Gene: NGR_c24770: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3708: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Rhizobium etli CFN 42

Gene: RHE_CH03278: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_2055: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Mesorhizobium loti MAFF303099

Gene: mll1643: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Brucella melitensis 16M

Gene: BMEI1639: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6035: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
Meso_2056
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_2056: Hypothetical protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical protein
 
CRON 7.
pntD
*
Sinorhizobium meliloti 1021

Site:
position = -157
score = 5.38298
sequence = TTTTTACCATCCGAAAAAAT

Gene: SMc02884: Predicted nucleoside ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -159
score = 5.20517
sequence = TTTTTACCATCCGAAAAATT

Gene: NGR_c35400: Predicted nucleoside ABC transporter, substrate-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -155
score = 5.11548
sequence = TCTTTACCAGCTGAAAAATT

Gene: RL0196: Predicted nucleoside ABC transporter, substrate-binding protein
*
Rhizobium etli CFN 42

Site:
position = -154
score = 4.84007
sequence = TCTTTACCGCCTGAAAAATT

Gene: RHE_CH00187: Predicted nucleoside ABC transporter, substrate-binding protein
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -164
score = 4.66015
sequence = GTTTTTCCACCGGGTCAAAA

Gene: Atu0126: Predicted nucleoside ABC transporter, substrate-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_3982: Predicted nucleoside ABC transporter, substrate-binding protein
*
Mesorhizobium loti MAFF303099

Site:
position = -165
score = 4.72736
sequence = GCTTTTCCAAAAGGTCAAAA

Gene: mlr3148: Predicted nucleoside ABC transporter, substrate-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted nucleoside ABC transporter, substrate-binding protein
pntA
*
Sinorhizobium meliloti 1021

Site:
position = -80
score = 5.2582
sequence = CTTATACCAAATGGTAAAAA

Gene: SMc04127: Predicted nucleoside ABC transporter, ATP-binding protein
*
Rhizobium sp. NGR234

Site:
position = -78
score = 5.2582
sequence = CTTATACCAAATGGTAAAAA

Gene: NGR_c34500: Predicted nucleoside ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0197: Predicted nucleoside ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH00188: Predicted nucleoside ABC transporter, ATP-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0127: Predicted nucleoside ABC transporter, ATP-binding protein
*
Mesorhizobium sp. BNC1

Site:
position = -18
score = 5.26567
sequence = TGTTGACCAAAAGATAAAAT

Gene: Meso_3652: Predicted nucleoside ABC transporter, ATP-binding protein
*
Mesorhizobium loti MAFF303099

Site:
position = -41
score = 5.57618
sequence = TTTTGACCAAGCGATAAAAA

Gene: mlr3154: Predicted nucleoside ABC transporter, ATP-binding protein
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted nucleoside ABC transporter, ATP-binding protein
pntB
 
Sinorhizobium meliloti 1021

Gene: SMc04126: Predicted nucleoside ABC transporter, permease protein 1
 
Rhizobium sp. NGR234

Gene: NGR_c34510: Predicted nucleoside ABC transporter, permease protein 1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0198: Predicted nucleoside ABC transporter, permease protein 1
 
Rhizobium etli CFN 42

Gene: RHE_CH00189: Predicted nucleoside ABC transporter, permease protein 1
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0128: Predicted nucleoside ABC transporter, permease protein 1
 
Mesorhizobium sp. BNC1

Gene: Meso_3653: Predicted nucleoside ABC transporter, permease protein 1
 
Mesorhizobium loti MAFF303099

Gene: mlr3155: Predicted nucleoside ABC transporter, permease protein 1
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted nucleoside ABC transporter, permease protein 1
pntC
 
Sinorhizobium meliloti 1021

Gene: SMc04125: Predicted nucleoside ABC transporter, permease protein 2
 
Rhizobium sp. NGR234

Gene: NGR_c34520: Predicted nucleoside ABC transporter, permease protein 2
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0199: Predicted nucleoside ABC transporter, permease protein 2
 
Rhizobium etli CFN 42

Gene: RHE_CH00190: Predicted nucleoside ABC transporter, permease protein 2
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0129: Predicted nucleoside ABC transporter, permease protein 2
 
Mesorhizobium sp. BNC1

Gene: Meso_3654: Predicted nucleoside ABC transporter, permease protein 2
 
Mesorhizobium loti MAFF303099

Gene: mlr3157: Predicted nucleoside ABC transporter, permease protein 2
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted nucleoside ABC transporter, permease protein 2
cdd
 
Sinorhizobium meliloti 1021

Gene: SMc04124: Cytidine deaminase (EC 3.5.4.5)
 
Rhizobium sp. NGR234

Gene: NGR_c34530: Cytidine deaminase (EC 3.5.4.5)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0200: Cytidine deaminase (EC 3.5.4.5)
 
Rhizobium etli CFN 42

Gene: RHE_CH00191: Cytidine deaminase (EC 3.5.4.5)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0130: Cytidine deaminase (EC 3.5.4.5)
 
Mesorhizobium sp. BNC1

Gene: Meso_3655: Cytidine deaminase (EC 3.5.4.5)
 
Mesorhizobium loti MAFF303099

Gene: mlr3158: Cytidine deaminase (EC 3.5.4.5)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Cytidine deaminase (EC 3.5.4.5)
deoD
 
Sinorhizobium meliloti 1021

Gene: SMc04123: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Rhizobium sp. NGR234

Gene: NGR_c34540: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0201: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00192: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0131: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_3656: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Mesorhizobium loti MAFF303099

Gene: mlr3159: Purine nucleoside phosphorylase (EC 2.4.2.1)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Purine nucleoside phosphorylase (EC 2.4.2.1)
deoC
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0202: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Rhizobium etli CFN 42

Gene: RHE_CH00193: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0132: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Deoxyribose-phosphate aldolase (EC 4.1.2.4)
deoA
 
Sinorhizobium meliloti 1021

Gene: SMc04122: Thymidine phosphorylase (EC 2.4.2.4)
 
Rhizobium sp. NGR234

Gene: NGR_c34550: Thymidine phosphorylase (EC 2.4.2.4)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0203: Thymidine phosphorylase (EC 2.4.2.4)
 
Rhizobium etli CFN 42

Gene: RHE_CH00194: Thymidine phosphorylase (EC 2.4.2.4)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0133: Thymidine phosphorylase (EC 2.4.2.4)
 
Mesorhizobium sp. BNC1

Gene: Meso_3657: Thymidine phosphorylase (EC 2.4.2.4)
 
Mesorhizobium loti MAFF303099

Gene: mlr3160: Thymidine phosphorylase (EC 2.4.2.4)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Thymidine phosphorylase (EC 2.4.2.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD