Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor (activator)
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 1 1
Burkholderia mallei ATCC 23344 1 1
Burkholderia sp. 383 6 2
Burkholderia cepacia AMMD 6 2
Burkholderia vietnamiensis G4 6 2
Burkholderia glumae BGR1
Burkholderia xenovorans LB400 6 2
Burkholderia phymatum STM815 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutR
*
Burkholderia pseudomallei K96243

Site:
position = -160
score = 6.65327
sequence = TCCTGTCCGAATGGTCAGGT

Gene: BPSS0273: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Burkholderia mallei ATCC 23344

Site:
position = -171
score = 6.65327
sequence = TCCTGTCCGAATGGTCAGGT

Gene: BMAA1492: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Burkholderia sp. 383

Site:
position = -196
score = 7.04496
sequence = TCCTGTCCGATTGGACAGGT

Gene: Bcep18194_C6653: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Burkholderia cepacia AMMD

Site:
position = -195
score = 7.04496
sequence = TCCTGTCCGATTGGACAGGT

Gene: Bamb_5968: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Burkholderia vietnamiensis G4

Site:
position = -195
score = 7.04496
sequence = TCCTGTCCGATTGGACAGGT

Gene: Bcep1808_5508: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -121
score = 6.71734
sequence = TCCTGTCCAGTTGGACAGGT

Gene: Bxe_A1426: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Burkholderia phymatum STM815

Site:
position = -216
score = 6.89527
sequence = TCCTGTCCGAATGGACAGGT

Gene: Bphy_1537: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 2.
pydC
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -180
score = 6.8329
sequence = ACCTGTCCAATCGGACAGGA

Gene: Bcep18194_C6654: Beta-ureidopropionase (EC 3.5.1.6)
*
Burkholderia cepacia AMMD

Site:
position = -188
score = 6.8329
sequence = ACCTGTCCAATCGGACAGGA

Gene: Bamb_5967: Beta-ureidopropionase (EC 3.5.1.6)
*
Burkholderia vietnamiensis G4

Site:
position = -186
score = 6.8329
sequence = ACCTGTCCAATCGGACAGGA

Gene: Bcep1808_5509: Beta-ureidopropionase (EC 3.5.1.6)
 
Burkholderia glumae BGR1
*
Burkholderia xenovorans LB400

Site:
position = -168
score = 6.64833
sequence = ACCTGTCCAACTGGACAGGA

Gene: Bxe_A1427: Beta-ureidopropionase (EC 3.5.1.6)
*
Burkholderia phymatum STM815

Site:
position = -200
score = 6.50528
sequence = ACCTGTCCATTCGGACAGGA

Gene: Bphy_1536: Beta-ureidopropionase (EC 3.5.1.6)
Beta-ureidopropionase (EC 3.5.1.6)
pydX
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_C6655: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Burkholderia cepacia AMMD

Gene: Bamb_5966: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5510: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1428: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
 
Burkholderia phymatum STM815

Gene: Bphy_1535: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
pydA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_C6656: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_5965: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5511: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1429: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
 
Burkholderia phymatum STM815

Gene: Bphy_1534: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2); Dihydroorotate dehydrogenase (EC 1.3.3.1)
pydP
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_C6657: Pyrimidine permease in reductive pathway
 
Burkholderia cepacia AMMD

Gene: Bamb_5964: Pyrimidine permease in reductive pathway
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5512: Pyrimidine permease in reductive pathway
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1430: Pyrimidine permease in reductive pathway
 
Burkholderia phymatum STM815

Gene: Bphy_1533: Pyrimidine permease in reductive pathway
Pyrimidine permease in reductive pathway
pydB
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_C6658: Dihydropyrimidinase (EC 3.5.2.2)
 
Burkholderia cepacia AMMD

Gene: Bamb_5963: Dihydropyrimidinase (EC 3.5.2.2)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5513: Dihydropyrimidinase (EC 3.5.2.2)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A1431: Dihydropyrimidinase (EC 3.5.2.2)
 
Burkholderia phymatum STM815

Gene: Bphy_1532: Dihydropyrimidinase (EC 3.5.2.2)
Dihydropyrimidinase (EC 3.5.2.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD