Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 8 4
Acinetobacter baumannii AB0057 1 1
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutA
*
Acinetobacter sp. ADP1

Site:
position = 15
score = 4.27133
sequence = TTTTGCCCCATCGGAAACAA

Site:
position = -193
score = 6.24061
sequence = ATTTTACTAAATGGTAAAAA

Gene: ACIAD0027: Pyrimidine oxygenase
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Pyrimidine oxygenase
rutB
 
Acinetobacter sp. ADP1

Gene: ACIAD0028: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Acinetobacter sp. ADP1

Gene: ACIAD0029: Aminoacrylate peracid reductase
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Aminoacrylate peracid reductase
rutF
 
Acinetobacter sp. ADP1

Gene: ACIAD0030: Flavin reductase
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Flavin reductase
rutG
 
Acinetobacter sp. ADP1

Gene: ACIAD0031: Uracil permease
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Uracil permease
 
CRON 2.
rutR
*
Acinetobacter sp. ADP1

Site:
position = -279
score = 6.0176
sequence = TTTTTACCATTTAGTAAAAT

Gene: ACIAD0026: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Acinetobacter baumannii AB0057

Gene: AB57_0065: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 3.
rutG2
*
Acinetobacter sp. ADP1

Site:
position = -176
score = 5.44411
sequence = TTTTTATTCATTGGTCAAAA

Site:
position = -129
score = 6.15035
sequence = TATTTACCATTTGGTAAAAT

Gene: ACIAD3628: Uracil permease
*
Acinetobacter baumannii AB0057

Site:
position = -116
score = 5.31137
sequence = ATTATACCGATCGTTAAAAA

Gene: AB57_3907: Uracil permease
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Uracil permease
 
CRON 4.
rutD
*
Acinetobacter sp. ADP1

Site:
position = -20
score = 6.13625
sequence = ATTTTACCAAATGGTTAAAA

Site:
position = -19
score = 4.24972
sequence = TTTTACCAAATGGTTAAAAA

Gene: ACIAD0025: Aminoacrylate hydrolase
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Aminoacrylate hydrolase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD