Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 12 4
Pseudomonas entomophila L48 8 3
Pseudomonas putida KT2440 7 2
Pseudomonas syringae pv. tomato str. DC3000 12 4
Pseudomonas fluorescens Pf-5 13 4
Pseudomonas mendocina ymp 12 5
Pseudomonas stutzeri A1501 4 3
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ppuA
*
Pseudomonas aeruginosa PAO1

Site:
position = -65
score = 5.37429
sequence = TCCTGACCTCCTGGCCAGGT

Gene: PA0136: Predicted ABC transporter, ATP-binding protein
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -64
score = 5.60056
sequence = ACCTGACCCATTGGCCAGGA

Gene: PSPTO0769: Predicted ABC transporter, ATP-binding protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -22
score = 5.38842
sequence = TCCTGACCCACTGGCCAGGA

Gene: PFL_0728: Predicted ABC transporter, ATP-binding protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_2907: Predicted ABC transporter, ATP-binding protein
 
Azotobacter vinelandii AvOP
Predicted ABC transporter, ATP-binding protein
ppuC
 
Pseudomonas aeruginosa PAO1

Gene: PA0137: Predicted ABC transporter, permease protein
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0768: Predicted ABC transporter, permease protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0727: Predicted ABC transporter, permease protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_2908: Predicted ABC transporter, permease protein
 
Azotobacter vinelandii AvOP
Predicted ABC transporter, permease protein
ppuD
 
Pseudomonas aeruginosa PAO1

Gene: PA0138: Predicted ABC transporter, inner membrane protein precursor
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0767: Predicted ABC transporter, inner membrane protein precursor
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0726: Predicted ABC transporter, inner membrane protein precursor
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_2909: Predicted ABC transporter, inner membrane protein precursor
 
Azotobacter vinelandii AvOP
Predicted ABC transporter, inner membrane protein precursor
 
CRON 2.
pbuT4
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -36
score = 5.57314
sequence = GCCTGACCAATCGGACAACA

Gene: Pmen_4444: Xanthine/uracil permease
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Xanthine/uracil permease
 
CRON 3.
upp
 
Pseudomonas aeruginosa PAO1

Gene: PA4646: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Pseudomonas entomophila L48

Gene: PSEEN0888: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Pseudomonas putida KT2440

Gene: PP0746: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1130: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5139: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Pseudomonas mendocina ymp

Gene: Pmen_0946: Uracil phosphoribosyltransferase (EC 2.4.2.9)
*
Pseudomonas stutzeri A1501

Site:
position = -159
score = 5.25418
sequence = ACCTGACCGAACAGACTACT

Gene: PST_3175: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Azotobacter vinelandii AvOP

Gene: Avin_41360: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Uracil phosphoribosyltransferase (EC 2.4.2.9)
uraA
 
Pseudomonas aeruginosa PAO1

Gene: PA4647: Uracil permease
 
Pseudomonas entomophila L48

Gene: PSEEN0887: Uracil permease
 
Pseudomonas putida KT2440

Gene: PP0745: Uracil permease
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1129: Uracil permease
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5140: Uracil permease
 
Pseudomonas mendocina ymp

Gene: Pmen_0945: Uracil permease
 
Pseudomonas stutzeri A1501

Gene: PST_3176: Uracil permease
 
Azotobacter vinelandii AvOP
Uracil permease
 
CRON 4.
tsx3
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -92
score = 5.39399
sequence = AGCTGATCAGTTGGACAGCT

Site:
position = -54
score = 5.72201
sequence = ACCTGACCACACGGCCAGGA

Gene: Pmen_3697: Nucleoside-binding outer membrane protein
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nucleoside-binding outer membrane protein
pbuT
*
Pseudomonas aeruginosa PAO1

Site:
position = -77
score = 5.27576
sequence = AGCTGATCACCTGGACAGCT

Gene: PA0166: Xanthine/uracil permease
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -83
score = 5.05087
sequence = ACCTGAGCAGGTGGACAGTT

Gene: PSPTO0772: Xanthine/uracil permease
*
Pseudomonas fluorescens Pf-5

Site:
position = -22
score = 5.34522
sequence = ACCTGAGCACCTGGACAGCT

Gene: PFL_0731: Xanthine/uracil permease
 
Pseudomonas mendocina ymp

Gene: Pmen_3698: Xanthine/uracil permease
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_29700: Xanthine/uracil permease
Xanthine/uracil permease
rutR
 
Pseudomonas aeruginosa PAO1

Gene: PA0167: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas entomophila L48

Gene: PSEEN0679: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas putida KT2440

Gene: PP0594: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0771: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0730: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas mendocina ymp

Gene: Pmen_3699: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudomonas stutzeri A1501

Gene: PST_2863: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Azotobacter vinelandii AvOP
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
COG1739
 
Pseudomonas aeruginosa PAO1

Gene: PA0168: hypothetical protein, COG1739
 
Pseudomonas entomophila L48

Gene: PSEEN0678: hypothetical protein, COG1739
 
Pseudomonas putida KT2440

Gene: PP0593: hypothetical protein, COG1739
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0770: hypothetical protein, COG1739
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0729: hypothetical protein, COG1739
 
Pseudomonas mendocina ymp

Gene: Pmen_3700: hypothetical protein, COG1739
 
Pseudomonas stutzeri A1501

Gene: PST_3607: hypothetical protein, COG1739
 
Azotobacter vinelandii AvOP
hypothetical protein, COG1739
 
CRON 5.
COG0726
*
Pseudomonas aeruginosa PAO1

Site:
position = -157
score = 5.9972
sequence = AACTGACCAGTCGGGCAGGT

Gene: PA1517: putative polysaccharide deacetylase family protein
*
Pseudomonas entomophila L48

Site:
position = -179
score = 6.02948
sequence = AACTGACCAATCGGGCAAGT

Gene: PSEEN1685: putative polysaccharide deacetylase family protein
*
Pseudomonas putida KT2440

Site:
position = -189
score = 5.97513
sequence = AGCTGACCAAACAGGCAGGT

Gene: PP4286: putative polysaccharide deacetylase family protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -169
score = 6.01396
sequence = AACTGACCAGTCAGGCAGGT

Gene: PSPTO3666: putative polysaccharide deacetylase family protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -189
score = 5.65122
sequence = AGCTGACCATCCAGGCAAGT

Gene: PFL_4366: putative polysaccharide deacetylase family protein
*
Pseudomonas mendocina ymp

Site:
position = -166
score = 5.77917
sequence = TGCTGACCACTCAGGCAATT

Gene: Pmen_2758: putative polysaccharide deacetylase family protein
 
Pseudomonas stutzeri A1501

Gene: PST_3093: putative polysaccharide deacetylase family protein
 
Azotobacter vinelandii AvOP

Gene: Avin_21130: putative polysaccharide deacetylase family protein
putative polysaccharide deacetylase family protein
pucL
 
Pseudomonas aeruginosa PAO1

Gene: PA1516: Uricase (EC 1.7.3.3)
 
Pseudomonas entomophila L48

Gene: PSEEN1684: Uricase (EC 1.7.3.3)
 
Pseudomonas putida KT2440

Gene: PP4287: Uricase (EC 1.7.3.3)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3667: Uricase (EC 1.7.3.3)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4367: Uricase (EC 1.7.3.3)
 
Pseudomonas mendocina ymp

Gene: Pmen_2759: Uricase (EC 1.7.3.3)
 
Pseudomonas stutzeri A1501

Gene: PST_3094: Uricase (EC 1.7.3.3)
 
Azotobacter vinelandii AvOP

Gene: Avin_21120: Uricase (EC 1.7.3.3)
Uricase (EC 1.7.3.3)
allC
 
Pseudomonas aeruginosa PAO1

Gene: PA1515: Allantoicase (EC 3.5.3.4)
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3668: Allantoicase (EC 3.5.3.4)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4368: Allantoicase (EC 3.5.3.4)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_3095: Allantoicase (EC 3.5.3.4)
 
Azotobacter vinelandii AvOP

Gene: Avin_21110: Allantoicase (EC 3.5.3.4)
Allantoicase (EC 3.5.3.4)
allA
 
Pseudomonas aeruginosa PAO1

Gene: PA1514: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas entomophila L48

Gene: PSEEN1683: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas putida KT2440

Gene: PP4288: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3669: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4369: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas mendocina ymp

Gene: Pmen_2760: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Pseudomonas stutzeri A1501

Gene: PST_3096: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Azotobacter vinelandii AvOP

Gene: Avin_21100: Ureidoglycolate hydrolase (EC 3.5.3.19)
Ureidoglycolate hydrolase (EC 3.5.3.19)
COG3748
 
Pseudomonas aeruginosa PAO1

Gene: PA1513: hypothetical protein, COG3748
 
Pseudomonas entomophila L48

Gene: PSEEN1682: hypothetical protein, COG3748
 
Pseudomonas putida KT2440

Gene: PP4289: hypothetical protein, COG3748
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3670: hypothetical protein, COG3748
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4370: hypothetical protein, COG3748
 
Pseudomonas mendocina ymp

Gene: Pmen_2761: hypothetical protein, COG3748
 
Pseudomonas stutzeri A1501

Gene: PST_3097: hypothetical protein, COG3748
 
Azotobacter vinelandii AvOP

Gene: Avin_21090: hypothetical protein, COG3748
hypothetical protein, COG3748
pbuT2
 
Pseudomonas aeruginosa PAO1

Gene: PA1507: Xanthine/uracil permease
 
Pseudomonas entomophila L48

Gene: PSEEN1681: Xanthine/uracil permease
 
Pseudomonas putida KT2440

Gene: PP4290: Xanthine/uracil permease
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4371: Xanthine/uracil permease
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Xanthine/uracil permease
tsx2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1680: Nucleoside-binding outer membrane protein
 
Pseudomonas putida KT2440

Gene: PP4291: Nucleoside-binding outer membrane protein
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nucleoside-binding outer membrane protein
 
CRON 6.
pbuT2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3157: Xanthine/uracil permease
*
Pseudomonas mendocina ymp

Site:
position = -100
score = 5.49641
sequence = TTCTGACCGACCAGACAGCT

Gene: Pmen_2762: Xanthine/uracil permease
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Xanthine/uracil permease
tsx
*
Pseudomonas aeruginosa PAO1

Site:
position = -62
score = 5.76728
sequence = GCCTGACCGCTCGGACAGGT

Gene: PA0165: Nucleoside-binding outer membrane protein
*
Pseudomonas entomophila L48

Site:
position = -349
score = 5.33518
sequence = ACCTGACCGAACGCCCAACT

Site:
position = -71
score = 5.23416
sequence = AGCTGACCCAAAAGACAAGA

Site:
position = -229
score = 5.15938
sequence = TACTGACCGCTCAGTCAATG

Gene: PSEEN1679: Nucleoside-binding outer membrane protein
*2
Pseudomonas putida KT2440

Site:
position = -231
score = 5.15938
sequence = TACTGACCGCTCAGTCAATG

Gene: PP4293: Nucleoside-binding outer membrane protein

Gene: PP3214: Nucleoside-binding outer membrane protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -98
score = 5.38597
sequence = AGCTGACCAGACAGACAAAA

Gene: PSPTO3671: Nucleoside-binding outer membrane protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -253
score = 5.36276
sequence = ACCTGACCCAAGAGCCAACT

Gene: PFL_4372: Nucleoside-binding outer membrane protein
 
Pseudomonas mendocina ymp

Gene: Pmen_2763: Nucleoside-binding outer membrane protein
*2
Pseudomonas stutzeri A1501

Site:
position = -58
score = 5.52839
sequence = GCCTGACCGCTTGGACAACT

Site:
position = -224
score = 5.10431
sequence = AGCTGACGCATCGGTCAGGT

Gene: PST_2862: Nucleoside-binding outer membrane protein

Gene: PST_3099: Nucleoside-binding outer membrane protein
 
Azotobacter vinelandii AvOP
Nucleoside-binding outer membrane protein
 
CRON 7.
pbuT3
 
Pseudomonas aeruginosa PAO1

Gene: PA1519: Xanthine/uracil permease
*
Pseudomonas entomophila L48

Site:
position = -121
score = 4.67418
sequence = TCCTGACCCAGAAGTCAACA

Gene: PSEEN1759: Xanthine/uracil permease
 
Pseudomonas putida KT2440

Gene: PP4284: Xanthine/uracil permease
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4364: Xanthine/uracil permease
*
Pseudomonas mendocina ymp

Site:
position = -123
score = 4.76637
sequence = TCTTGACCGCTCGGTCAACA

Gene: Pmen_2756: Xanthine/uracil permease
*
Pseudomonas stutzeri A1501

Site:
position = -63
score = 5.12352
sequence = TCCTGACCTTTCGGTCAACT

Gene: PST_3090: Xanthine/uracil permease
 
Azotobacter vinelandii AvOP
Xanthine/uracil permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD