Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 21 4
Marinobacter aqueolei
Marinobacter sp. ELB17 5 3
Oceanobacter sp. RED65 11 3
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1 14 5
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901 11 3
Cellvibrio japonicus Ueda107 14 3
Chromohalobacter salexigens DSM 3043 4 2
Reinekea sp. MED297 11 3
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xdhA
*
Hahella chejuensis KCTC 2396

Site:
position = -157
score = 5.22625
sequence = ACCTGACCATGTAGACAAGT

Gene: HCH_01099: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -196
score = 5.22433
sequence = ACTAGACTATTTGGTCAGGT

Gene: MELB17_16808: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Oceanobacter sp. RED65

Site:
position = -230
score = 5.42876
sequence = AACTGACCATATGGACAGAA

Site:
position = -125
score = 5.70112
sequence = AGCTGACTAATTGGTCAGAT

Gene: RED65_04290: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -83
score = 4.96178
sequence = ATTTGTACGATTGGTCAGGT

Gene: Mmwyl1_2699: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Saccharophagus degradans 2-40
*
Teredinibacter turnerae T7901

Site:
position = -252
score = 4.66985
sequence = ATTTGACCACTAGGACAAAT

Site:
position = -89
score = 5.64764
sequence = ACCTGACCGAATGGCCAGCT

Gene: TERTU_2067: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Cellvibrio japonicus Ueda107

Site:
position = -201
score = 4.84897
sequence = ACCTGACTGCACGGACAAAA

Site:
position = -77
score = 4.16204
sequence = AATTGTCTATTTGGCCAGTC

Gene: CJA_0546: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Chromohalobacter salexigens DSM 3043

Site:
position = -75
score = 4.98954
sequence = AGTTGACCAGATGGTCATAC

Gene: Csal_1789: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Reinekea sp. MED297

Site:
position = -147
score = 5.86323
sequence = ACCTGACCGCATGGTCAGCT

Gene: MED297_08316: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Alcanivorax borkumensis SK2
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB
 
Hahella chejuensis KCTC 2396

Gene: HCH_01098: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16813: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Oceanobacter sp. RED65

Gene: RED65_04295: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2698: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2066: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0547: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1788: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Reinekea sp. MED297

Gene: MED297_08321: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Alcanivorax borkumensis SK2
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC
 
Hahella chejuensis KCTC 2396

Gene: HCH_01097: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16818: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Oceanobacter sp. RED65

Gene: RED65_04300: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2697: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2065: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0548: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1787: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Reinekea sp. MED297

Gene: MED297_08326: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Alcanivorax borkumensis SK2
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
allB
 
Hahella chejuensis KCTC 2396

Gene: HCH_01096: Allantoinase (EC 3.5.2.5)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_08331: Allantoinase (EC 3.5.2.5)
 
Alcanivorax borkumensis SK2
Allantoinase (EC 3.5.2.5)
allC
 
Hahella chejuensis KCTC 2396

Gene: HCH_01095: Allantoicase (EC 3.5.3.4)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_04305: Allantoicase (EC 3.5.3.4)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Allantoicase (EC 3.5.3.4)
pucL
 
Hahella chejuensis KCTC 2396

Gene: HCH_01094: Uricase (EC 1.7.3.3)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_04310: Uricase (EC 1.7.3.3)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2064: Uricase (EC 1.7.3.3)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0549: Uricase (EC 1.7.3.3)
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_08336: Uricase (EC 1.7.3.3)
 
Alcanivorax borkumensis SK2
Uricase (EC 1.7.3.3)
pucM
 
Hahella chejuensis KCTC 2396

Gene: HCH_01093: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_04315: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2063: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0550: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_08341: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Alcanivorax borkumensis SK2
Hydroxyisourate hydrolase (EC 3.5.2.17)
allA
 
Hahella chejuensis KCTC 2396

Gene: HCH_01092: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_04320: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Ureidoglycolate hydrolase (EC 3.5.3.19)
guaD
 
Hahella chejuensis KCTC 2396

Gene: HCH_01091: Guanine deaminase (EC 3.5.4.3)
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -114
score = 4.49207
sequence = TGCTGACTTAGTGGTCAAGT

Gene: MELB17_16798: Guanine deaminase (EC 3.5.4.3)
 
Oceanobacter sp. RED65

Gene: RED65_04325: Guanine deaminase (EC 3.5.4.3)
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -62
score = 4.00852
sequence = GTATAACCATTCGGTCAAAC

Gene: Mmwyl1_1677: Guanine deaminase (EC 3.5.4.3)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2062: Guanine deaminase (EC 3.5.4.3)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0551: Guanine deaminase (EC 3.5.4.3)
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -156
score = 4.33158
sequence = TGTTGACCATGTGGTTAGGA

Gene: MED297_06818: Guanine deaminase (EC 3.5.4.3)
 
Alcanivorax borkumensis SK2
Guanine deaminase (EC 3.5.4.3)
COG3748
 
Hahella chejuensis KCTC 2396

Gene: HCH_01090: Predicted inner membrane protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_04330: Predicted inner membrane protein
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2061: Predicted inner membrane protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_0552: Predicted inner membrane protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_08346: Predicted inner membrane protein
 
Alcanivorax borkumensis SK2
Predicted inner membrane protein
 
CRON 2.
hpt
 
Hahella chejuensis KCTC 2396

Gene: HCH_03840: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_15473: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Oceanospirillum sp. MED92

Gene: MED92_03213: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
*
Teredinibacter turnerae T7901

Site:
position = -96
score = 5.79743
sequence = TTCTGACCAAATGGTCAGCT

Gene: TERTU_2072: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0580: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_18333: Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
 
Alcanivorax borkumensis SK2
Hypoxanthine-guanine phosphoribosyltransferase (EC 2.4.2.8)
nupP
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2071: Predicted purine nucleoside permease
*
Cellvibrio japonicus Ueda107

Site:
position = -70
score = 4.35473
sequence = ATCCATCCAAATGGTCAATT

Gene: CJA_0583: Predicted purine nucleoside permease
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Predicted purine nucleoside permease
 
CRON 3.
pbuT
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
*
Oceanobacter sp. RED65

Site:
position = -127
score = 4.36979
sequence = TTTTAACCCTCTGGTCAGGT

Gene: RED65_12897: Xanthine/uracil permease
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -117
score = 4.85931
sequence = TACTGACCAAATGATCAGTT

Gene: Mmwyl1_1566: Xanthine/uracil permease
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Xanthine/uracil permease
 
CRON 4.
ppuA
*2
Hahella chejuensis KCTC 2396

Site:
position = -235
score = 5.2023
sequence = AGTTGATCAATTGGTCAAAT

Site:
position = -208
score = 5.03013
sequence = AACTGACCAGTTGGCCAAAA

Gene: HCH_01101: Predicted ABC transporter, ATP-binding protein

Site:
position = -111
score = 5.10681
sequence = TCTTGACTACTTGGTCAGAA

Gene: HCH_02310: Predicted ABC transporter, ATP-binding protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*2
Marinomonas sp. MWYL1

Site:
position = -185
score = 4.46966
sequence = TATTAACTAGTCGGTCAGAT

Gene: Mmwyl1_1926: Predicted ABC transporter, ATP-binding protein

Gene: Mmwyl1_0633: Predicted ABC transporter, ATP-binding protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
*
Cellvibrio japonicus Ueda107

Site:
position = -165
score = 4.51594
sequence = GACTGGCCAAATAGACAATT

Site:
position = -41
score = 4.42269
sequence = TTTTGTCCGTGCAGTCAGGT

Gene: CJA_0545: Predicted ABC transporter, ATP-binding protein
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -2
score = 4.30815
sequence = TCATGACTGCTCAGACAGAT

Gene: MED297_21307: Predicted ABC transporter, ATP-binding protein
 
Alcanivorax borkumensis SK2
Predicted ABC transporter, ATP-binding protein
ppuC
 2
Hahella chejuensis KCTC 2396

Gene: HCH_01102: Predicted ABC transporter, permease protein

Gene: HCH_02311: Predicted ABC transporter, permease protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 2
Marinomonas sp. MWYL1

Gene: Mmwyl1_1925: Predicted ABC transporter, permease protein

Gene: Mmwyl1_0634: Predicted ABC transporter, permease protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0544: Predicted ABC transporter, permease protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_21302: Predicted ABC transporter, permease protein
 
Alcanivorax borkumensis SK2
Predicted ABC transporter, permease protein
ppuD
 2
Hahella chejuensis KCTC 2396

Gene: HCH_01103: Predicted ABC transporter, inner membrane protein precursor

Gene: HCH_02312: Predicted ABC transporter, inner membrane protein precursor
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 2
Marinomonas sp. MWYL1

Gene: Mmwyl1_1924: Predicted ABC transporter, inner membrane protein precursor

Gene: Mmwyl1_0635: Predicted ABC transporter, inner membrane protein precursor
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0543: Predicted ABC transporter, inner membrane protein precursor
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_21297: Predicted ABC transporter, inner membrane protein precursor
 
Alcanivorax borkumensis SK2
Predicted ABC transporter, inner membrane protein precursor
ppuB
*2
Hahella chejuensis KCTC 2396

Gene: HCH_01105: Predicted ABC transporter, substrate-binding protein precursor

Site:
position = -106
score = 5.03421
sequence = ACCTGTCCGGCTGGTCATAA

Gene: HCH_01504: Predicted ABC transporter, substrate-binding protein precursor
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*2
Marinomonas sp. MWYL1

Gene: Mmwyl1_1923: Predicted ABC transporter, substrate-binding protein precursor

Site:
position = -64
score = 4.05008
sequence = TTTTGACCAGTTAGGCAGGG

Gene: Mmwyl1_0632: Predicted ABC transporter, substrate-binding protein precursor
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0542: Predicted ABC transporter, substrate-binding protein precursor
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Predicted ABC transporter, substrate-binding protein precursor
ssnA
 
Hahella chejuensis KCTC 2396

Gene: HCH_01106: Predicted chlorohydrolase/aminohydrolase
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_2070: Predicted chlorohydrolase/aminohydrolase
 
Cellvibrio japonicus Ueda107

Gene: CJA_0540: Predicted chlorohydrolase/aminohydrolase
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Predicted chlorohydrolase/aminohydrolase
rutR
 
Hahella chejuensis KCTC 2396

Gene: HCH_01108: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -240
score = 5.32593
sequence = ACCTGACCAAATAGTCTAGT

Gene: MELB17_16803: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Oceanobacter sp. RED65

Gene: RED65_04280: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1423: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Saccharophagus degradans 2-40
*
Teredinibacter turnerae T7901

Site:
position = -72
score = 4.57341
sequence = ATTTGTCCTAGTGGTCAAAT

Site:
position = -235
score = 5.31474
sequence = AGCTGGCCATTCGGTCAGGT

Gene: TERTU_2069: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Cellvibrio japonicus Ueda107

Gene: CJA_0541: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Chromohalobacter salexigens DSM 3043

Site:
position = -87
score = 4.98392
sequence = GTATGACCATCTGGTCAACT

Gene: Csal_1790: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Reinekea sp. MED297

Gene: MED297_01515: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Alcanivorax borkumensis SK2
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
add
 
Hahella chejuensis KCTC 2396

Gene: HCH_01503: Adenosine deaminase (EC 3.5.4.4)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_16728: Adenosine deaminase (EC 3.5.4.4)
*
Oceanobacter sp. RED65

Site:
position = -35
score = 4.88894
sequence = TCCTGATCAGATAGTCAATT

Gene: RED65_11380: Adenosine deaminase (EC 3.5.4.4)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1922: Adenosine deaminase (EC 3.5.4.4)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_3230: Adenosine deaminase (EC 3.5.4.4)
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1983: Adenosine deaminase (EC 3.5.4.4)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Adenosine deaminase (EC 3.5.4.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD