Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36 8 4
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutR
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -155
score = 4.12949
sequence = AACTGACTCCCGGGTCAAGT

Gene: PE36_18369: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 2.
pbuT
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -379
score = 5.29469
sequence = TATTGACCATCAAGTCAATT

Gene: PE36_19145: Xanthine/uracil permease
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Xanthine/uracil permease
xpt
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_19150: Xanthine phosphoribosyltransferase (EC 2.4.2.22)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Xanthine phosphoribosyltransferase (EC 2.4.2.22)
 
CRON 3.
xdhA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -118
score = 5.11861
sequence = ACTTGACTCGAGGGTCAGGT

Gene: PE36_18399: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_18394: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_18389: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
guaD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_18384: Guanine deaminase (EC 3.5.4.3)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Guanine deaminase (EC 3.5.4.3)
 
CRON 4.
gpt
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -146
score = 4.74783
sequence = ACTTGTCCCAAGGGTCAAGT

Gene: PE36_22205: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3424: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0890: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
 
Tolumonas auensis DSM 9187

Gene: Tola_0808: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD