Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 16 7
Alteromonas macleodii 'Deep ecotype' 13 6
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H 13 3
Alteromonadales bacterium TW-7 9 2
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp2
*
Pseudoalteromonas atlantica T6c

Site:
position = -112
score = 5.73278
sequence = ACCTGACCATTTGGACAAGT

Gene: Patl_2225: putative TonB-dependent outer membrane transporter
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -124
score = 5.22752
sequence = AGTTGACCAACTGGTTAAGT

Gene: MADE_02502: putative TonB-dependent outer membrane transporter
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative TonB-dependent outer membrane transporter
 
CRON 2.
add2
*
Pseudoalteromonas atlantica T6c

Site:
position = -27
score = 5.51419
sequence = GACTGACCATTTGGTCAAAT

Gene: Patl_2222: Adenosine deaminase (EC 3.5.4.4)
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Adenosine deaminase (EC 3.5.4.4)
pbuT2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2223: Xanthine/uracil permease
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -353
score = 5.48481
sequence = AACAGACCAGTTGGTCAACA

Gene: MADE_02501: Xanthine/uracil permease
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Xanthine/uracil permease
 
CRON 3.
udk
*
Pseudoalteromonas atlantica T6c

Site:
position = -180
score = 5.32455
sequence = ACTTGACCATATGGTCCACA

Gene: Patl_0533: Uridine kinase (EC 2.7.1.48)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -183
score = 4.93652
sequence = AACTGACCACTTGGAGAACT

Gene: MADE_00730: Uridine kinase (EC 2.7.1.48)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007092: Uridine kinase (EC 2.7.1.48)
*
Colwellia psychrerythraea 34H

Site:
position = -182
score = 5.06412
sequence = CTATGACCAACTGGTCAAGT

Gene: CPS_1974: Uridine kinase (EC 2.7.1.48)
 
Alteromonadales bacterium TW-7

Gene: ATW7_01080: Uridine kinase (EC 2.7.1.48)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0080: Uridine kinase (EC 2.7.1.48)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03621: Uridine kinase (EC 2.7.1.48)
 
Idiomarina baltica OS145

Gene: OS145_01217: Uridine kinase (EC 2.7.1.48)
 
Idiomarina loihiensis L2TR

Gene: IL1536: Uridine kinase (EC 2.7.1.48)
Uridine kinase (EC 2.7.1.48)
nupX
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0532: Nucleoside permease
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00729: Nucleoside permease
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007087: Nucleoside permease
 
Colwellia psychrerythraea 34H

Gene: CPS_1973: Nucleoside permease
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0079: Nucleoside permease
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03616: Nucleoside permease
 
Idiomarina baltica OS145

Gene: OS145_01212: Nucleoside permease
 
Idiomarina loihiensis L2TR

Gene: IL1535: Nucleoside permease
Nucleoside permease
 
CRON 4.
cdd
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0790: Cytidine deaminase (EC 3.5.4.5)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01844: Cytidine deaminase (EC 3.5.4.5)
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -70
score = 5.78909
sequence = ACTTGACCATATGGTCAGCA

Gene: CPS_1969: Cytidine deaminase (EC 3.5.4.5)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Cytidine deaminase (EC 3.5.4.5)
deoA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1970: Thymidine phosphorylase (EC 2.4.2.4)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_10005: Thymidine phosphorylase (EC 2.4.2.4)
 
Idiomarina loihiensis L2TR

Gene: IL1882: Thymidine phosphorylase (EC 2.4.2.4)
Thymidine phosphorylase (EC 2.4.2.4)
 
CRON 5.
xdhA
*
Pseudoalteromonas atlantica T6c

Site:
position = -91
score = 5.69836
sequence = ACCTGACCAACTGGTCTGGT

Gene: Patl_2424: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -83
score = 5.76872
sequence = AATTGACCATTTGGTCTACT

Gene: MADE_02515: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -94
score = 3.51291
sequence = AGCTGACACTTGTGTCAACT

Gene: CPS_4864: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
*
Alteromonadales bacterium TW-7

Site:
position = -148
score = 4.9395
sequence = AGTTAACCGATCGGTCAGGC

Site:
position = -328
score = 5.08432
sequence = ACATATCCTTTTGGTCAGGT

Gene: ATW7_02017: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2425: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02516: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4865: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Alteromonadales bacterium TW-7

Gene: ATW7_02012: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2426: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02517: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4866: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Alteromonadales bacterium TW-7

Gene: ATW7_02007: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
allB
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4867: Allantoinase (EC 3.5.2.5)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Allantoinase (EC 3.5.2.5)
allC
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4868: Allantoicase (EC 3.5.3.4)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Allantoicase (EC 3.5.3.4)
pucL
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2427: Uricase (EC 1.7.3.3)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02518: Uricase (EC 1.7.3.3)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4869: Uricase (EC 1.7.3.3)
 
Alteromonadales bacterium TW-7

Gene: ATW7_02002: Uricase (EC 1.7.3.3)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Uricase (EC 1.7.3.3)
pucM
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2428: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02519: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4870: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Alteromonadales bacterium TW-7

Gene: ATW7_01997: Hydroxyisourate hydrolase (EC 3.5.2.17)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Hydroxyisourate hydrolase (EC 3.5.2.17)
allA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4871: Ureidoglycolate hydrolase (EC 3.5.3.19)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Ureidoglycolate hydrolase (EC 3.5.3.19)
guaD
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2429: Guanine deaminase (EC 3.5.4.3)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02520: Guanine deaminase (EC 3.5.4.3)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4872: Guanine deaminase (EC 3.5.4.3)
 
Alteromonadales bacterium TW-7

Gene: ATW7_01992: Guanine deaminase (EC 3.5.4.3)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Guanine deaminase (EC 3.5.4.3)
COG3748
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2430: hypothetical protein, COG3748
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02521: hypothetical protein, COG3748
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_4873: hypothetical protein, COG3748
 
Alteromonadales bacterium TW-7

Gene: ATW7_01987: hypothetical protein, COG3748
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein, COG3748
COG0726
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2422: putative polysaccharide deacetylase family protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02512: putative polysaccharide deacetylase family protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_01982: putative polysaccharide deacetylase family protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
putative polysaccharide deacetylase family protein
rutR
*
Pseudoalteromonas atlantica T6c

Site:
position = -242
score = 5.87522
sequence = ACCAGACCAGTTGGTCAGGT

Gene: Patl_2423: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02513: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Glaciecola sp. HTCC2999
 2
Colwellia psychrerythraea 34H

Gene: CPS_1965: Transcriptional regulator RutR of pyrimidine catabolism, TetR family

Gene: CPS_4876: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Alteromonadales bacterium TW-7

Site:
position = -61
score = 5.32283
sequence = AATTGACCTTTCGGTCAGTA

Gene: ATW7_02067: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
CRON 6.
pbuT
*
Pseudoalteromonas atlantica T6c

Site:
position = -98
score = 5.21399
sequence = GCTAGACTAAATGGTCAGGT

Gene: Patl_2421: Xanthine/uracil permease
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -71
score = 5.73003
sequence = AGTTGACTAATTGGTCAGTT

Gene: MADE_02510: Xanthine/uracil permease
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Xanthine/uracil permease
 
CRON 7.
omp1
*
Pseudoalteromonas atlantica T6c

Site:
position = -127
score = 4.29998
sequence = TTTTGACCAGTTAGTCAAAT

Gene: Patl_0536: putative TonB-dependent outer membrane transporter
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -207
score = 5.68405
sequence = ACTTGACCATGTGGTCAGGT

Gene: MADE_00733: putative TonB-dependent outer membrane transporter
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1968: putative TonB-dependent outer membrane transporter
 
Alteromonadales bacterium TW-7

Gene: ATW7_02752: putative TonB-dependent outer membrane transporter
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0340: putative TonB-dependent outer membrane transporter
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03406: putative TonB-dependent outer membrane transporter
 
Idiomarina baltica OS145

Gene: OS145_04710: putative TonB-dependent outer membrane transporter
 
Idiomarina loihiensis L2TR

Gene: IL0583: putative TonB-dependent outer membrane transporter
putative TonB-dependent outer membrane transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD