Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio vulnificus CMCP6
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio shilonii AK1 4 1
Vibrio splendidus LGP32
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14
Photobacterium profundum SS9 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xdhA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -86
score = 4.93679
sequence = AGTTGACCTCTTGGTCAAAT

Site:
position = -58
score = 6.03515
sequence = TATTGACCCAAAGGTCAGAA

Gene: VSAK1_25090: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -47
score = 5.92876
sequence = TATTGACTCAAAGGTCAGAA

Site:
position = -74
score = 5.61122
sequence = AGTTGACTAAAAAGTCAGCT

Gene: PBPRA2243: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
xdhB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_25085: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA2244: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
xdhC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_25080: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA2245: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
guaD
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_25075: Guanine deaminase (EC 3.5.4.3)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA2246: Guanine deaminase (EC 3.5.4.3)
Guanine deaminase (EC 3.5.4.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD