Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor (activator)
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000
Ralstonia pickettii 12J
Ralstonia metallidurans CH34 5 1
Ralstonia eutropha JMP134 9 1
Ralstonia eutropha H16 5 1
Cupriavidus taiwanensis 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ribA2
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -45
score = 6.94751
sequence = ACCTGACCAACTGGTCAGGT

Gene: Rmet_4572: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
*
Ralstonia eutropha JMP134

Site:
position = -45
score = 7.13329
sequence = ACTTGACCATTTGGTCAGGA

Gene: Reut_B3985: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
*
Ralstonia eutropha H16

Site:
position = -43
score = 7.31907
sequence = ACCTGACCATTTGGTCAGGA

Gene: H16_B1597: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
*
Cupriavidus taiwanensis

Site:
position = -43
score = 7.13329
sequence = ACCTGACCGATTGGTCAGGA

Gene: RALTA_B1434: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
PF07958
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_4571: Conserved hypothetical protein
 
Ralstonia eutropha JMP134

Gene: Reut_B3986: Conserved hypothetical protein
 
Ralstonia eutropha H16

Gene: H16_B1596: Conserved hypothetical protein
 
Cupriavidus taiwanensis

Gene: RALTA_B1433: Conserved hypothetical protein
Conserved hypothetical protein
upp
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_4570: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Ralstonia eutropha JMP134

Gene: Reut_B3987: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Ralstonia eutropha H16

Gene: H16_B1595: Uracil phosphoribosyltransferase (EC 2.4.2.9)
 
Cupriavidus taiwanensis

Gene: RALTA_B1432: Uracil phosphoribosyltransferase (EC 2.4.2.9)
Uracil phosphoribosyltransferase (EC 2.4.2.9)
rutR
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_4569: Transcriptional regulator, TetR family
 
Ralstonia eutropha JMP134

Gene: Reut_B3988: Transcriptional regulator, TetR family
 
Ralstonia eutropha H16

Gene: H16_B1594: Transcriptional regulator, TetR family
 
Cupriavidus taiwanensis

Gene: RALTA_B1431: Transcriptional regulator, TetR family
Transcriptional regulator, TetR family
ppuB
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134

Gene: Reut_B3989: Predicted ABC transporter, substrate-binding protein precursor
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Predicted ABC transporter, substrate-binding protein precursor
ppuA
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134

Gene: Reut_B3990: Predicted ABC transporter, ATP-binding protein
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Predicted ABC transporter, ATP-binding protein
ppuC
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134

Gene: Reut_B3991: Predicted ABC transporter, permease protein
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Predicted ABC transporter, permease protein
ppuD
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134

Gene: Reut_B3992: Predicted ABC transporter, inner membrane protein precursor
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Predicted ABC transporter, inner membrane protein precursor
codA
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_4568: Cytosine deaminase (EC 3.5.4.1)
 
Ralstonia eutropha JMP134

Gene: Reut_B3993: Cytosine deaminase (EC 3.5.4.1)
 
Ralstonia eutropha H16

Gene: H16_B1593: Cytosine deaminase (EC 3.5.4.1)
 
Cupriavidus taiwanensis

Gene: RALTA_B1430: Cytosine deaminase (EC 3.5.4.1)
Cytosine deaminase (EC 3.5.4.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD