Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 70 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 34 22
Caulobacter segnis ATCC 21756 30 19
Caulobacter sp. K31 30 21
Phenylobacterium zucineum HLK1 7 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acdH
*
Caulobacter crescentus CB15

Site:
position = -47
score = 5.89313
sequence = CTTCAAACAAGCGTTTGACA

Gene: CC0690: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Caulobacter segnis ATCC 21756

Site:
position = -46
score = 5.89313
sequence = CTTCAAACAAGTGTTTGACA

Gene: Cseg_3689: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Caulobacter sp. K31

Site:
position = -45
score = 5.92873
sequence = TTTCAAACAAGCGTTTGACA

Gene: Caul_4071: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Phenylobacterium zucineum HLK1

Site:
position = -32
score = 5.97578
sequence = ATTCAAACAAGCGTTTGAAC

Gene: PHZ_c3174: Acyl-CoA dehydrogenase (EC 1.3.99.3)
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 2.
CC0244
*
Caulobacter crescentus CB15

Site:
position = -25
score = 5.50524
sequence = GCTCAAACAAGCGTTTGAGG

Gene: CC0244: HAD-superfamily hydrolase
*
Caulobacter segnis ATCC 21756

Site:
position = -27
score = 5.55563
sequence = CCTCAAACAATTGTTTGAGG

Gene: Cseg_0190: HAD-superfamily hydrolase
*
Caulobacter sp. K31

Site:
position = -25
score = 5.33973
sequence = GATCAAACAGTTGTTTGAGG

Gene: Caul_4647: HAD-superfamily hydrolase
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0076: HAD-superfamily hydrolase
HAD-superfamily hydrolase
phhB
 
Caulobacter crescentus CB15

Gene: CC0245: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0191: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Caulobacter sp. K31

Gene: Caul_4648: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0077: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
CC0246
*
Caulobacter crescentus CB15

Site:
position = -41
score = 5.52
sequence = ATTCAAACTGCTGTTTGAAT

Gene: CC0246: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase
*
Caulobacter segnis ATCC 21756

Site:
position = -40
score = 5.61749
sequence = ATTCAAACTCGCGTTTGAAT

Gene: Cseg_0192: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase
*
Caulobacter sp. K31

Site:
position = -40
score = 5.79331
sequence = GTTCAAACTATCGTTTGAAT

Gene: Caul_4649: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0078: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase
2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase
 
CRON 3.
paaI2
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -42
score = 5.82967
sequence = AGTCAAACAAATGTTTGAAT

Gene: Caul_4897: Phenylacetic acid degradation protein paaI
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1939: Phenylacetic acid degradation protein paaI
Phenylacetic acid degradation protein paaI
 
CRON 4.
paaI
*
Caulobacter crescentus CB15

Site:
position = -26
score = 5.00147
sequence = TTTCAAACGCTTGTTAGCCT

Gene: CC3309: Phenylacetic acid degradation protein paaI
*
Caulobacter segnis ATCC 21756

Site:
position = -26
score = 5.14027
sequence = TTTCAAACGATCGTTAGCCT

Gene: Cseg_0614: Phenylacetic acid degradation protein paaI
*
Caulobacter sp. K31

Site:
position = -26
score = 5.44987
sequence = GTTCAAACGCTCGTTAGACT

Gene: Caul_0887: Phenylacetic acid degradation protein paaI
 
Phenylobacterium zucineum HLK1
Phenylacetic acid degradation protein paaI
CC3308
 
Caulobacter crescentus CB15

Gene: CC3308: alpha/beta hydrolase fold protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0615: alpha/beta hydrolase fold protein
 
Caulobacter sp. K31

Gene: Caul_0888: alpha/beta hydrolase fold protein
*
Phenylobacterium zucineum HLK1

Site:
position = -116
score = 5.18426
sequence = TTTCAAACGGCCGTTAGACC

Gene: PHZ_c3105: alpha/beta hydrolase fold protein
alpha/beta hydrolase fold protein
 
CRON 5.
CC2074
*
Caulobacter crescentus CB15

Site:
position = -29
score = 5.052
sequence = ATCCGAACACCTGTTCGAAA

Gene: CC2074: Bll6692 protein
*
Caulobacter segnis ATCC 21756

Site:
position = -28
score = 5.1908
sequence = ATCCGAACAACCGTTCGAAA

Gene: Cseg_1354: Bll6692 protein
*
Caulobacter sp. K31

Site:
position = -41
score = 5.47838
sequence = CTTCGAACAATCGTTCGAAA

Gene: Caul_3321: Bll6692 protein
*
Phenylobacterium zucineum HLK1

Site:
position = -36
score = 5.31248
sequence = GTTCAAACGATTGTTCGCCT

Gene: PHZ_c0904: Bll6692 protein
Bll6692 protein
psrA
*
Caulobacter crescentus CB15

Site:
position = -46
score = 4.37099
sequence = ATTCGAACGCCCGTAAGACT

Gene: CC2080: Transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0903: Transcriptional regulator for fatty acid degradation PsrA, TetR family
Transcriptional regulator for fatty acid degradation PsrA, TetR family
 
CRON 6.
CC3076
*
Caulobacter crescentus CB15

Site:
position = -28
score = 5.26147
sequence = ATTCAAACAAACGTTTAGGG

Gene: CC3076: Oxidoreductase, short-chain dehydrogenase/reductase family
*
Caulobacter segnis ATCC 21756

Site:
position = -28
score = 5.26147
sequence = ATTCAAACAAACGTTTAGGG

Gene: Cseg_3639: Oxidoreductase, short-chain dehydrogenase/reductase family
*
Caulobacter sp. K31

Site:
position = -28
score = 5.38057
sequence = ATTCAAACAAACGTTTAGCG

Gene: Caul_0851: Oxidoreductase, short-chain dehydrogenase/reductase family
*
Phenylobacterium zucineum HLK1

Site:
position = -39
score = 5.44558
sequence = AGTCAAACAACTGTTTGGGA

Gene: PHZ_c3135: Oxidoreductase, short-chain dehydrogenase/reductase family
Oxidoreductase, short-chain dehydrogenase/reductase family
 
CRON 7.
fadB
*
Caulobacter crescentus CB15

Site:
position = -45
score = 5.21868
sequence = TGTCAAACAACCGTTCAAAC

Gene: CC3189: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Caulobacter segnis ATCC 21756

Site:
position = -166
score = 4.79426
sequence = ACTGAAACTATCGTTCGAAT

Site:
position = -52
score = 4.79241
sequence = TCTCAAACGGTTGTTCAAGC

Gene: Cseg_0771: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Caulobacter sp. K31

Site:
position = -53
score = 5.40245
sequence = CTTCAAACAACCGTTCAAAA

Gene: Caul_0813: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Phenylobacterium zucineum HLK1

Site:
position = -81
score = 4.61358
sequence = CCTATAACACGCGTTTGAAT

Gene: PHZ_c3217: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadD
 
Caulobacter crescentus CB15

Gene: CC3188: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0772: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Caulobacter sp. K31

Gene: Caul_0814: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2510: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 8.
fadA
*
Caulobacter crescentus CB15

Site:
position = -34
score = 5.35264
sequence = ATTCAAACTAACGTTTAACG

Gene: CC3462: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Caulobacter segnis ATCC 21756

Site:
position = -34
score = 5.08613
sequence = ATTCAAACTAATGTTTTAAC

Gene: Cseg_0226: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Caulobacter sp. K31

Site:
position = -34
score = 5.39117
sequence = ATTCAAACTAACGTTTAAAG

Gene: Caul_4752: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Phenylobacterium zucineum HLK1

Site:
position = -53
score = 5.03282
sequence = GTTCCAACGCTTGTTTAAAA

Gene: PHZ_c0760: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 9.
CC2049
*
Caulobacter crescentus CB15

Site:
position = -89
score = 5.39627
sequence = ATGCGAACGATCGTTTGAAT

Gene: CC2049: Acyl-CoA dehydrogenase family protein
*
Caulobacter segnis ATCC 21756

Site:
position = -113
score = 5.03636
sequence = CGGCGAACGAGCGTTTGAAT

Gene: Cseg_1384: Acyl-CoA dehydrogenase family protein
*
Caulobacter sp. K31

Site:
position = -119
score = 4.77876
sequence = TGACGAACGGACGTTTGAAT

Gene: Caul_1447: Acyl-CoA dehydrogenase family protein
 
Phenylobacterium zucineum HLK1
Acyl-CoA dehydrogenase family protein
Cseg_1383
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1383: DSBA oxidoreductase
 
Caulobacter sp. K31

Gene: Caul_1446: DSBA oxidoreductase
 
Phenylobacterium zucineum HLK1
DSBA oxidoreductase
CC2050
 
Caulobacter crescentus CB15

Gene: CC2050: Acyl-CoA dehydrogenase family protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1382: Acyl-CoA dehydrogenase family protein
 
Caulobacter sp. K31

Gene: Caul_1445: Acyl-CoA dehydrogenase family protein
 
Phenylobacterium zucineum HLK1
Acyl-CoA dehydrogenase family protein
 
CRON 10.
echH
*
Caulobacter crescentus CB15

Site:
position = -39
score = 5.10832
sequence = GGTCATACGATCGTTTAAAA

Gene: CC0947: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)
*
Caulobacter segnis ATCC 21756

Site:
position = -45
score = 5.38576
sequence = GGTCATACGATCGTTTGAAA

Gene: Cseg_3348: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)
*
Caulobacter sp. K31

Site:
position = -43
score = 5.15101
sequence = GTTCATACGCGTGTTTGAGT

Gene: Caul_1349: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2717: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)
Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)
 
CRON 11.
CC1568
*
Caulobacter crescentus CB15

Site:
position = -27
score = 5.37676
sequence = TCTCAAACAATTGTTTGGGA

Gene: CC1568: Beta-lactamase class C and other penicillin binding proteins
*
Caulobacter segnis ATCC 21756

Site:
position = -27
score = 5.11358
sequence = TGTCAAACGAGTGTTCGGGA

Gene: Cseg_2635: Beta-lactamase class C and other penicillin binding proteins
*
Caulobacter sp. K31

Site:
position = -30
score = 4.99298
sequence = CCTCAAACAACTGTTCGGGA

Gene: Caul_3066: Beta-lactamase class C and other penicillin binding proteins
 
Phenylobacterium zucineum HLK1
Beta-lactamase class C and other penicillin binding proteins
CC1569
 
Caulobacter crescentus CB15

Gene: CC1569: NADP-dependent quinone oxidoreductase, putative
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2634: NADP-dependent quinone oxidoreductase, putative
 
Caulobacter sp. K31

Gene: Caul_3065: NADP-dependent quinone oxidoreductase, putative
 
Phenylobacterium zucineum HLK1
NADP-dependent quinone oxidoreductase, putative
fabL
 
Caulobacter crescentus CB15

Gene: CC1570: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2633: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)
 
Caulobacter sp. K31

Gene: Caul_3064: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)
 
Phenylobacterium zucineum HLK1
ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)
 
CRON 12.
CC3380
*
Caulobacter crescentus CB15

Site:
position = -41
score = 5.33371
sequence = CTTCAAACAAGCGTTTCAAG

Gene: CC3380: Short-chain dehydrogenase/reductase SDR
*
Caulobacter segnis ATCC 21756

Site:
position = -39
score = 5.26773
sequence = CTTCAAACAAGCGTTCAAGA

Gene: Cseg_0314: Short-chain dehydrogenase/reductase SDR
*
Caulobacter sp. K31

Site:
position = -30
score = 4.9578
sequence = TTTCGAACAAATGTTCGGGA

Gene: Caul_4412: Short-chain dehydrogenase/reductase SDR
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1079: Short-chain dehydrogenase/reductase SDR
Short-chain dehydrogenase/reductase SDR
 
CRON 13.
CC0942
*
Caulobacter crescentus CB15

Site:
position = -30
score = 5.31562
sequence = ATCCAAACAACTGTTCGAGG

Gene: CC0942: aldehyde dehydrogenase
*
Caulobacter segnis ATCC 21756

Site:
position = -31
score = 5.30362
sequence = ATCCAAACAAATGTTTGGGA

Gene: Cseg_3353: aldehyde dehydrogenase
*
Caulobacter sp. K31

Site:
position = -41
score = 4.97376
sequence = AATCAAACAACTGTTTACAA

Gene: Caul_1346: aldehyde dehydrogenase
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2720: aldehyde dehydrogenase
aldehyde dehydrogenase
 
CRON 14.
CC1310
*
Caulobacter crescentus CB15

Site:
position = -86
score = 4.95329
sequence = TTCCAAACGGCCGTTCGAGC

Gene: CC1310: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
*
Caulobacter segnis ATCC 21756

Site:
position = -87
score = 5.19171
sequence = TTCCAAACGGTCGTTCGACC

Gene: Cseg_1597: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
*
Caulobacter sp. K31

Site:
position = -82
score = 5.30482
sequence = TTCCAAACGCTCGTTCGAAC

Gene: Caul_2048: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2336: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
CC1311
 
Caulobacter crescentus CB15

Gene: CC1311: Acyl-CoA dehydrogenase family protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1598: Acyl-CoA dehydrogenase family protein
 
Caulobacter sp. K31

Gene: Caul_2049: Acyl-CoA dehydrogenase family protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2335: Acyl-CoA dehydrogenase family protein
Acyl-CoA dehydrogenase family protein
 
CRON 15.
CC0427
*
Caulobacter crescentus CB15

Site:
position = -69
score = 5.23925
sequence = GGCAAAACAAGCGTTTGACG

Gene: CC0427: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Caulobacter segnis ATCC 21756

Site:
position = -64
score = 5.17304
sequence = GTCAAAACAGATGTTTGACA

Gene: Cseg_3758: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Caulobacter sp. K31

Site:
position = -35
score = 5.23176
sequence = CGCAAAACAAGTGTTTGAAG

Gene: Caul_0274: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 16.
CC3087
*
Caulobacter crescentus CB15

Site:
position = -34
score = 4.62752
sequence = AAGAAAACAACTGTTTGGGC

Gene: CC3087: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)
*
Caulobacter segnis ATCC 21756

Site:
position = -52
score = 4.92723
sequence = AAGAAAACAATTGTTTGGCT

Site:
position = -34
score = 5.18752
sequence = CTTAAAACACCTGTTTGGCC

Gene: Cseg_3655: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)
*
Caulobacter sp. K31

Site:
position = -34
score = 4.76953
sequence = AAGAAAACAACTGTTTGGCG

Gene: Caul_1059: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c3145: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)
Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)
 
CRON 17.
CC2093
*
Caulobacter crescentus CB15

Site:
position = -31
score = 5.05432
sequence = AACCAAACACACGTTTGAGG

Gene: CC2093: Oxidoreductase, short chain dehydrogenase/reductase family
*
Caulobacter segnis ATCC 21756

Site:
position = -31
score = 5.10362
sequence = AACCAAACACGCGTTTGAGG

Gene: Cseg_1333: Oxidoreductase, short chain dehydrogenase/reductase family
*
Caulobacter sp. K31

Site:
position = -31
score = 5.10362
sequence = AACCAAACACGCGTTTGAGG

Gene: Caul_3341: Oxidoreductase, short chain dehydrogenase/reductase family
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0881: Oxidoreductase, short chain dehydrogenase/reductase family
Oxidoreductase, short chain dehydrogenase/reductase family
fadL
 
Caulobacter crescentus CB15

Gene: CC2094: Long-chain fatty acid transport protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1332: Long-chain fatty acid transport protein
 
Caulobacter sp. K31

Gene: Caul_3342: Long-chain fatty acid transport protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0773: Long-chain fatty acid transport protein
Long-chain fatty acid transport protein
 
CRON 18.
CC3089
*
Caulobacter crescentus CB15

Site:
position = -70
score = 4.83742
sequence = GGGCGAACAGATGTTTGACT

Gene: CC3089: Bll1370 protein
*
Caulobacter segnis ATCC 21756

Site:
position = -68
score = 4.79013
sequence = CGACGAACGCGCGTTTGACG

Gene: Cseg_0869: Bll1370 protein
*
Caulobacter sp. K31

Site:
position = -70
score = 4.99748
sequence = ATCCGAACATCCGTTTGACT

Gene: Caul_4261: Bll1370 protein
 
Phenylobacterium zucineum HLK1
Bll1370 protein
 
CRON 19.
CC2407
*
Caulobacter crescentus CB15

Site:
position = -40
score = 4.52955
sequence = CATCTAACAAGTGTTTGATC

Gene: CC1111: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1757: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Caulobacter sp. K31

Site:
position = -29
score = 4.98052
sequence = CGTCAAACATCCGTTCGAGA

Gene: Caul_1696: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Phenylobacterium zucineum HLK1
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
CC1110
 
Caulobacter crescentus CB15

Gene: CC1110: acyl-CoA dehydrogenase family protein
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
acyl-CoA dehydrogenase family protein
CC1109
 
Caulobacter crescentus CB15

Gene: CC1109: COGs COG3777
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
COGs COG3777
 
CRON 20.
fadD2
*
Caulobacter crescentus CB15

Site:
position = -99
score = 4.9729
sequence = CCTCAAACGCATGTTTGCAT

Gene: CC1321: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -97
score = 4.95619
sequence = GTTCGAACAGACGTTTGCAT

Gene: Caul_2153: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1345: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 21.
Cseg_2255
*
Caulobacter crescentus CB15

Site:
position = -30
score = 4.82557
sequence = CGCCCAACGAACGTTTGAAT

Gene: CC1967: acetyl-CoA acetyltransferase
*
Caulobacter segnis ATCC 21756

Site:
position = -30
score = 4.85294
sequence = CCCCCAACGATCGTTTGAAT

Gene: Cseg_2255: acetyl-CoA acetyltransferase
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1574: acetyl-CoA acetyltransferase
acetyl-CoA acetyltransferase
CC1966
 
Caulobacter crescentus CB15

Gene: CC1966: phosphoglycerate mutase family protein
 2
Caulobacter segnis ATCC 21756

Gene: Cseg_1359: phosphoglycerate mutase family protein

Gene: Cseg_2254: phosphoglycerate mutase family protein
 2
Caulobacter sp. K31

Gene: Caul_2851: phosphoglycerate mutase family protein

Gene: Caul_3318: phosphoglycerate mutase family protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1575: phosphoglycerate mutase family protein
phosphoglycerate mutase family protein
CC1965
 
Caulobacter crescentus CB15

Gene: CC1965: YjeF protein, function unknown
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2253: YjeF protein, function unknown
 
Caulobacter sp. K31

Gene: Caul_2850: YjeF protein, function unknown
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c1576: YjeF protein, function unknown
YjeF protein, function unknown
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD