Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021
Rhizobium sp. NGR234
Rhizobium leguminosarum bv. viciae 3841
Rhizobium etli CFN 42
Agrobacterium tumefaciens str. C58 (Cereon)
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009 2 2
Bradyrhizobium japonicum USDA 110 2 2
Bradyrhizobium sp. BTAi1 2 2
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acdH
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -214
score = 5.84905
sequence = ATTCAAACAGCTGTATGAAA

Site:
position = -201
score = 5.64406
sequence = TATGAAACTATCGTTTCACA

Gene: RPA3289: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Bradyrhizobium japonicum USDA 110

Site:
position = -189
score = 6.01806
sequence = ATTCAAACAGTTGTATGAAA

Site:
position = -176
score = 5.71179
sequence = TATGAAACTATCGTTTGAAG

Gene: bll5455: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Bradyrhizobium sp. BTAi1

Site:
position = -179
score = 5.93901
sequence = TATGAAACTATTGTTTGAGA

Site:
position = -192
score = 6.41428
sequence = TTTCAAACAATTGTATGAAA

Gene: BBta_5105: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 2.
psrA
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -63
score = 5.64406
sequence = TGTGAAACGATAGTTTCATA

Site:
position = -50
score = 5.84905
sequence = TTTCATACAGCTGTTTGAAT

Gene: RPA3290: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Bradyrhizobium japonicum USDA 110

Site:
position = -169
score = 5.71179
sequence = CTTCAAACGATAGTTTCATA

Site:
position = -156
score = 6.01806
sequence = TTTCATACAACTGTTTGAAT

Gene: blr5456: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Bradyrhizobium sp. BTAi1

Site:
position = -41
score = 6.41428
sequence = TTTCATACAATTGTTTGAAA

Site:
position = -54
score = 5.93901
sequence = TCTCAAACAATAGTTTCATA

Gene: BBta_5106: Transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Transcriptional regulator for fatty acid degradation PsrA, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD