Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1 9 1
Thauera sp. MZ1T 7 1
Dechloromonas aromatica RCB 13 3
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472 16 10
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9 16 12
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acdH
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -106
score = 5.68419
sequence = ATTTAAACAAACGTTTGAAC

Gene: CV1785: Probable acyl-CoA dehydrogenase
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -54
score = 5.95297
sequence = ATCCAAACATTCGTTTGAAA

Site:
position = -21
score = 5.48601
sequence = TTTCAAACGGTCGTTTAACC

Gene: LHK_02264: Probable acyl-CoA dehydrogenase
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Probable acyl-CoA dehydrogenase
 
CRON 2.
CV3117
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3117: probable acyl-CoA-binding protein
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -88
score = 5.81484
sequence = GTTCAAACGATCGTTTTATT

Gene: LHK_02384: probable acyl-CoA-binding protein
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
probable acyl-CoA-binding protein
 
CRON 3.
etfD
 3
Azoarcus sp. EbN1

Gene: c2A178: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: c1A56: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: ebA6155: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Thauera sp. MZ1T

Gene: Tmz1t_1656: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 2
Dechloromonas aromatica RCB

Gene: Daro_1936: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: Daro_0228: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -108
score = 5.65568
sequence = GTTTAAACGCTTGTTTGATT

Gene: CV3916: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Neisseria meningitidis MC58

Gene: NMB0581: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Laribacter hongkongensis HLHK9

Site:
position = -97
score = 5.85457
sequence = ATTCAAACGGCCGTTTGACG

Gene: LHK_02892: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Methylobacillus flagellatus KT

Gene: Mfla_0725: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Methylotenera mobilis JLW8

Gene: Mmol_0149: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Methylophilales bacterium HTCC2181
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
CRON 4.
LHK_00066
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -68
score = 5.87752
sequence = ATTCAAACAGTCGTTTGATG

Gene: LHK_00066: Putative enoyl-CoA hydratase
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Putative enoyl-CoA hydratase
 
CRON 5.
psrA
*
Azoarcus sp. EbN1

Site:
position = -28
score = 6.30502
sequence = ATTAAAACGATCGTTTGAAT

Gene: c1A220: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Thauera sp. MZ1T

Site:
position = -34
score = 4.65712
sequence = AAGAAAACGTATGATTCAAA

Site:
position = -21
score = 6.20648
sequence = ATTCAAACAAACGTTTGAAA

Gene: Tmz1t_0804: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Dechloromonas aromatica RCB

Site:
position = -34
score = 5.99814
sequence = ATTCAAACGAACGTATGAAT

Gene: Daro_1543: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -84
score = 5.56132
sequence = GTTAAAACGTAAGTTTGAAA

Site:
position = -71
score = 5.34233
sequence = TTTGAAACGCTTGTTCGAAA

Gene: CV2724: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -38
score = 5.41024
sequence = ATTAAAACGTAAGTTTCAAA

Site:
position = -25
score = 5.55272
sequence = TTTCAAACAACTGTTTGGAT

Gene: LHK_01607: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
 
Azoarcus sp. EbN1

Gene: c1A18: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Thauera sp. MZ1T

Gene: Tmz1t_0805: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Dechloromonas aromatica RCB

Gene: Daro_1544: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1548: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0094: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV2723: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
fadA
 
Azoarcus sp. EbN1

Gene: c1A212: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Thauera sp. MZ1T

Gene: Tmz1t_0806: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Dechloromonas aromatica RCB

Gene: Daro_1545: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadB
 
Azoarcus sp. EbN1

Gene: c1A208: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Thauera sp. MZ1T

Gene: Tmz1t_0807: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Dechloromonas aromatica RCB

Gene: Daro_1547: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
c1A206
 
Azoarcus sp. EbN1

Gene: c1A206: Acyl-CoA hydrolase (EC 3.1.2.20)
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0096: Acyl-CoA hydrolase (EC 3.1.2.20)
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV2722: Acyl-CoA hydrolase (EC 3.1.2.20)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Acyl-CoA hydrolase (EC 3.1.2.20)
fadL
 
Azoarcus sp. EbN1

Gene: c1A203: Long-chain fatty acid transport protein
 
Thauera sp. MZ1T

Gene: Tmz1t_0808: Long-chain fatty acid transport protein
*
Dechloromonas aromatica RCB

Site:
position = -122
score = 4.68328
sequence = TTTCCAACAGTCATTTGAAT

Site:
position = -83
score = 5.84216
sequence = TTTCAAACGTTTGTTTGAGA

Gene: Daro_1548: Long-chain fatty acid transport protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_2596: Long-chain fatty acid transport protein
*
Chromobacterium violaceum ATCC 12472

Site:
position = -136
score = 4.84986
sequence = CATTAAACGAACGTTTGGAA

Gene: CV2721: Long-chain fatty acid transport protein
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -142
score = 5.59656
sequence = TATAAAACGGCTGTTTGAAA

Site:
position = -63
score = 4.91262
sequence = TCTCAAACGATCGTTTGCCT

Gene: LHK_01608: Long-chain fatty acid transport protein
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Long-chain fatty acid transport protein
acdB
 
Azoarcus sp. EbN1

Gene: ebA2315: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Thauera sp. MZ1T

Gene: Tmz1t_0809: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Dechloromonas aromatica RCB

Site:
position = -58
score = 5.98978
sequence = ATTCAAACGTTCGTTTTATT

Gene: Daro_1549: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1528: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0097: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -257
score = 5.06615
sequence = ATAAAAGCGAGTGTTTGATA

Gene: CV2720: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01609: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
acdA
 
Azoarcus sp. EbN1

Gene: ebA2314: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Thauera sp. MZ1T

Gene: Tmz1t_0810: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Dechloromonas aromatica RCB

Gene: Daro_1550: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1527: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0098: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV2719: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_01610: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
echH
 
Azoarcus sp. EbN1

Gene: ebA2313: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Enoyl-CoA hydratase (EC 4.2.1.17)
Daro_1551
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1551: hypothetical protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -24
score = 6.10582
sequence = ATCCAAACGACCGTTTGAAT

Gene: CV3350: hypothetical protein
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -22
score = 5.63554
sequence = TTTCAAACGATCGTTTGCTT

Gene: LHK_02202: hypothetical protein
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
hypothetical protein
Daro_1552
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1552: FIG026291: Hypothetical periplasmic protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
FIG026291: Hypothetical periplasmic protein
fadD
 
Azoarcus sp. EbN1

Gene: ebA4749: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Thauera sp. MZ1T

Gene: Tmz1t_3077: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Dechloromonas aromatica RCB

Gene: Daro_1553: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -137
score = 4.70228
sequence = GATCAAACCGCGGTTTGATC

Gene: CV1459: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Neisseria meningitidis MC58

Gene: NMB1555: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Laribacter hongkongensis HLHK9

Site:
position = -107
score = 5.58424
sequence = AATCAAACGACCGTTTGGCT

Gene: LHK_01931: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Daro_1554
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1554: Dioxygenases related to 2-nitropropane dioxygenase
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Dioxygenases related to 2-nitropropane dioxygenase
acdH
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1555: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Acyl-CoA dehydrogenase (EC 1.3.99.3)
Daro_1546
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1546: DegV family protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DegV family protein
 
CRON 6.
etfB
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -101
score = 5.93636
sequence = AACCAAACGCTCGTTTGAAT

Gene: CV3818: Electron transfer flavoprotein, beta subunit
 
Neisseria meningitidis MC58

Gene: NMB2155: Electron transfer flavoprotein, beta subunit
*
Laribacter hongkongensis HLHK9

Site:
position = -187
score = 6.13001
sequence = ATTCAAACGACTGTTTGAAG

Gene: LHK_02913: Electron transfer flavoprotein, beta subunit
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Electron transfer flavoprotein, beta subunit
etfA
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3817: Electron transfer flavoprotein, alpha subunit
 
Neisseria meningitidis MC58

Gene: NMB2154: Electron transfer flavoprotein, alpha subunit
 
Laribacter hongkongensis HLHK9

Gene: LHK_02912: Electron transfer flavoprotein, alpha subunit
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Electron transfer flavoprotein, alpha subunit
acdH2
 
Azoarcus sp. EbN1

Gene: ebA5321: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Thauera sp. MZ1T

Gene: Tmz1t_2488: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV3816: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02910: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 7.
fabK
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -78
score = 6.03289
sequence = ATTAAAACATTCGTTTGAAA

Gene: CV2194: Enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9)
 
CRON 8.
fadH
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472

Gene: CV0169: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = 43
score = 5.96959
sequence = AATCAAACGGTCGTTTGACA

Gene: LHK_00049: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
CRON 9.
scp
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -40
score = 5.79439
sequence = TATCAAACACTCGTTTGATA

Gene: LHK_02406: SCP-2 sterol transfer family
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
SCP-2 sterol transfer family
 
CRON 10.
fabF
 
Azoarcus sp. EbN1

Gene: ebA5459: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Thauera sp. MZ1T

Gene: Tmz1t_2324: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Dechloromonas aromatica RCB

Gene: Daro_2019: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1650: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A1076: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Thiobacillus denitrificans

Gene: Tbd_1547: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
*
Chromobacterium violaceum ATCC 12472

Site:
position = -91
score = 5.61093
sequence = TTCCAAACGCGCGTTTGAAC

Gene: CV3412: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Neisseria meningitidis MC58

Gene: NMB0219: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
*
Laribacter hongkongensis HLHK9

Site:
position = -90
score = 5.37905
sequence = AGGCAAACGCCCGTTTGACA

Gene: LHK_00568: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Methylobacillus flagellatus KT

Gene: Mfla_1503: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Methylotenera mobilis JLW8

Gene: Mmol_1141: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Methylophilales bacterium HTCC2181

Gene: MB2181_04435: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
CRON 11.
fadD2
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
*
Chromobacterium violaceum ATCC 12472

Site:
position = -18
score = 5.18422
sequence = ATTAAAACCATCGTTTGCAT

Gene: CV4051: Probable long chain fatty-acid CoA ligase
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_00715: Probable long chain fatty-acid CoA ligase
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Probable long chain fatty-acid CoA ligase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD