Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 7 2
Burkholderia mallei ATCC 23344 7 2
Burkholderia sp. 383 7 2
Burkholderia cepacia AMMD 7 2
Burkholderia vietnamiensis G4 6 2
Burkholderia glumae BGR1 7 2
Burkholderia xenovorans LB400 11 2
Burkholderia phymatum STM815 11 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
psrA
*
Burkholderia pseudomallei K96243

Site:
position = -74
score = 5.22417
sequence = ATGAAAACGGCTGTTTCAAT

Gene: BPSL1882: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia mallei ATCC 23344

Site:
position = -74
score = 5.22417
sequence = ATGAAAACGGCTGTTTCAAT

Gene: BMA1275: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia sp. 383

Site:
position = -73
score = 5.41146
sequence = ATAAAAACGACTGTTTGAAT

Gene: Bcep18194_A4675: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia cepacia AMMD

Site:
position = -74
score = 5.62789
sequence = ATAAAAACGGCTGTTTGAAT

Gene: Bamb_1417: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia vietnamiensis G4

Site:
position = -74
score = 5.31925
sequence = ATAAAAACAGCCGTTTGAAT

Gene: Bcep1808_1501: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia glumae BGR1

Site:
position = -72
score = 5.29821
sequence = ATAAAAACGCTTGTTTCAAT

Gene: bglu_1g19670: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia xenovorans LB400

Site:
position = -76
score = 5.10587
sequence = AAAAAAACGGTCGTTTCAAA

Gene: Bxe_A2773: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Burkholderia phymatum STM815

Site:
position = -100
score = 4.33911
sequence = AAAAGAACGCACGTTTCAAA

Gene: Bphy_1699: Transcriptional regulator for fatty acid degradation PsrA, TetR family
Transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A2774: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Burkholderia phymatum STM815

Gene: Bphy_1700: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
fabG
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A2775: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia phymatum STM815

Gene: Bphy_1701: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
Bxe_A2776
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A2776: Putative (R)-specific enoyl-CoA hydratase, MaoC- like
 
Burkholderia phymatum STM815

Gene: Bphy_1702: Putative (R)-specific enoyl-CoA hydratase, MaoC- like
Putative (R)-specific enoyl-CoA hydratase, MaoC- like
fadA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400

Gene: Bxe_A2777: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Burkholderia phymatum STM815

Gene: Bphy_1703: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadD
 
Burkholderia pseudomallei K96243

Gene: BPSL1883: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia mallei ATCC 23344

Gene: BMA1276: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia sp. 383

Gene: Bcep18194_A4674: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia cepacia AMMD

Gene: Bamb_1416: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1500: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia glumae BGR1

Gene: bglu_1g19680: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia xenovorans LB400

Gene: Bxe_A2778: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Burkholderia phymatum STM815

Gene: Bphy_1704: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 2.
fabH
*
Burkholderia pseudomallei K96243

Site:
position = -177
score = 5.88868
sequence = GATCAAACGCGGGTATGATG

Gene: BPSL2442: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia mallei ATCC 23344

Site:
position = -177
score = 5.88868
sequence = GATCAAACGCGGGTATGATG

Gene: BMA0530: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia sp. 383

Site:
position = -178
score = 5.88868
sequence = GATCAAACGCGGGTATGATG

Gene: Bcep18194_A4233: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia cepacia AMMD

Site:
position = -178
score = 5.34742
sequence = GATCAAACGGGGTTATGATG

Gene: Bamb_0997: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia vietnamiensis G4

Site:
position = -178
score = 5.88868
sequence = GATCAAACGCGGGTATGATG

Gene: Bcep1808_1040: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia glumae BGR1

Site:
position = -178
score = 5.72065
sequence = CATCAAACGCGGGTATGATG

Gene: bglu_1g09510: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia xenovorans LB400

Site:
position = -177
score = 5.77882
sequence = TATCAAACGCGGGTATGATG

Gene: Bxe_A1072: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Burkholderia phymatum STM815

Site:
position = -201
score = 6.00722
sequence = AATCAAACGCGGGTATGATG

Gene: Bphy_0828: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
fabD
 
Burkholderia pseudomallei K96243

Gene: BPSL2441: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia mallei ATCC 23344

Gene: BMA0531: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia sp. 383

Gene: Bcep18194_A4234: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia cepacia AMMD

Gene: Bamb_0998: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1041: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia glumae BGR1

Gene: bglu_1g09520: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia xenovorans LB400

Gene: Bxe_A1073: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Burkholderia phymatum STM815

Gene: Bphy_0829: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
fabG
 
Burkholderia pseudomallei K96243

Gene: BPSL2440: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia mallei ATCC 23344

Gene: BMA0532: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia sp. 383

Gene: Bcep18194_A4235: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia cepacia AMMD

Gene: Bamb_0999: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1042: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia glumae BGR1

Gene: bglu_1g09530: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia xenovorans LB400

Gene: Bxe_A1074: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Burkholderia phymatum STM815

Gene: Bphy_0830: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
acpP
 
Burkholderia pseudomallei K96243

Gene: BPSL2439: Acyl carrier protein
 
Burkholderia mallei ATCC 23344

Gene: BMA0533: Acyl carrier protein
 
Burkholderia sp. 383

Gene: Bcep18194_A4236: Acyl carrier protein
 
Burkholderia cepacia AMMD

Gene: Bamb_1000: Acyl carrier protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1043: Acyl carrier protein
 
Burkholderia glumae BGR1

Gene: bglu_1g09540: Acyl carrier protein
 
Burkholderia xenovorans LB400

Gene: Bxe_A1075: Acyl carrier protein
 
Burkholderia phymatum STM815

Gene: Bphy_0831: Acyl carrier protein
Acyl carrier protein
fabF
 
Burkholderia pseudomallei K96243

Gene: BPSL2438: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia mallei ATCC 23344

Gene: BMA0534: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia sp. 383

Gene: Bcep18194_A4237: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia cepacia AMMD

Gene: Bamb_1001: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1044: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia glumae BGR1

Gene: bglu_1g09550: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia xenovorans LB400

Gene: Bxe_A1076: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Burkholderia phymatum STM815

Gene: Bphy_0832: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD