Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306 7 2
Xanthomonas campestris pv. campestris str. ATCC 33913 7 2
Stenotrophomonas maltophilia K279a 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
psrA
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -37
score = 5.56467
sequence = ACTCAAACAATCGTTTGATT

Gene: XAC2014: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -37
score = 5.56467
sequence = ACTCAAACAATCGTTTGATT

Gene: XCC1980: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Stenotrophomonas maltophilia K279a

Site:
position = -35
score = 5.73595
sequence = TATCAAACAATCGTTTGATT

Gene: Smlt2053: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadB
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2013: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1979: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2052: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
fadA
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1978: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2051: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
CRON 2.
aroQ
 
Xylella fastidiosa 9a5c

Gene: XF0047: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -96
score = 5.06225
sequence = TTTAAAACAATCGTTTTAAA

Gene: XAC0533: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -96
score = 5.45498
sequence = AATCAAACGATTGTTTAAAA

Gene: XCC0518: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
*
Stenotrophomonas maltophilia K279a

Site:
position = -96
score = 5.29949
sequence = TTTCAAACGTTCGATTGAAA

Gene: Smlt4239: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
3-dehydroquinate dehydratase II (EC 4.2.1.10)
bccP
 
Xylella fastidiosa 9a5c

Gene: XF0048: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0532: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0517: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
 
Stenotrophomonas maltophilia K279a

Gene: Smlt4240: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Biotin carboxyl carrier protein of acetyl-CoA carboxylase
XAC0531
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0531: 23S RNA associated protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0516: 23S RNA associated protein
 
Stenotrophomonas maltophilia K279a
23S RNA associated protein
accC
 
Xylella fastidiosa 9a5c

Gene: XF0049: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC0530: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0515: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
 
Stenotrophomonas maltophilia K279a

Gene: Smlt4241: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
 
CRON 3.
etfD
 
Xylella fastidiosa 9a5c

Gene: XF1298: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC3575: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC0630: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Stenotrophomonas maltophilia K279a

Site:
position = -84
score = 4.82845
sequence = ATTCAAACAACCGTTTCGCC

Gene: Smlt0198: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD