Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 13 8
Pseudomonas entomophila L48 13 10
Pseudomonas putida KT2440 13 10
Pseudomonas syringae pv. tomato str. DC3000 11 8
Pseudomonas fluorescens Pf-5 12 9
Pseudomonas mendocina ymp 11 8
Pseudomonas stutzeri A1501 10 7
Azotobacter vinelandii AvOP 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acdH1
*
Pseudomonas aeruginosa PAO1

Site:
position = -139
score = 5.53238
sequence = TTTCAAACGCCTGTTTGAGA

Gene: PA0506: probable acyl-CoA dehydrogenase
*
Pseudomonas entomophila L48

Site:
position = -87
score = 5.74221
sequence = TTTCAAACAACTGTTTGACC

Gene: PSEEN5115: probable acyl-CoA dehydrogenase
*
Pseudomonas putida KT2440

Site:
position = -73
score = 5.76969
sequence = TTTCAAACAACTGTTTGATC

Gene: PP0368: probable acyl-CoA dehydrogenase
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -113
score = 5.64499
sequence = TTTCAAACACCTGTTTGACC

Gene: PSPTO0500: probable acyl-CoA dehydrogenase
*
Pseudomonas fluorescens Pf-5

Site:
position = -78
score = 5.74221
sequence = TTTCAAACAACTGTTTGACC

Gene: PFL_5687: probable acyl-CoA dehydrogenase
*
Pseudomonas mendocina ymp

Site:
position = -125
score = 5.8922
sequence = TTTCAAACGCCTGTTTGATT

Gene: Pmen_4081: probable acyl-CoA dehydrogenase
*
Pseudomonas stutzeri A1501

Site:
position = -71
score = 4.72076
sequence = GTCGAAACGTATGTTTCAAA

Site:
position = -58
score = 5.69898
sequence = TTTCAAACGCCTGTTTGACC

Gene: PST_3860: probable acyl-CoA dehydrogenase
 
Azotobacter vinelandii AvOP

Gene: Avin_45920: probable acyl-CoA dehydrogenase
probable acyl-CoA dehydrogenase
acdH2
 
Pseudomonas aeruginosa PAO1

Gene: PA0507: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Acyl-CoA dehydrogenase (EC 1.3.99.3)
acdH3
 
Pseudomonas aeruginosa PAO1

Gene: PA0508: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 2.
PA1831
*
Pseudomonas aeruginosa PAO1

Site:
position = -84
score = 5.66777
sequence = ATTCAAACAAGCGTATGTTT

Gene: PA1831: Phosphoglycerate mutase family protein
*
Pseudomonas entomophila L48

Site:
position = -99
score = 5.19022
sequence = GTTCAAACGACCTTTTCAAA

Site:
position = -86
score = 5.65247
sequence = TTTCAAACGCTTGTATGTTT

Gene: PSEEN2270: Phosphoglycerate mutase family protein
*
Pseudomonas putida KT2440

Site:
position = -98
score = 5.29054
sequence = TTTCAAACAACCTTTTCAAA

Site:
position = -85
score = 5.65247
sequence = TTTCAAACGCTTGTATGTTT

Gene: PP3923: Phosphoglycerate mutase family protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -89
score = 5.75435
sequence = TTTCAAACGAGCGTATGTTT

Gene: PSPTO2726: Phosphoglycerate mutase family protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -88
score = 5.70036
sequence = TTTCAAACAAGCGTATGTTT

Gene: PFL_3668: Phosphoglycerate mutase family protein
*
Pseudomonas mendocina ymp

Site:
position = -89
score = 5.66777
sequence = ATTCAAACAAGCGTATGTTT

Gene: Pmen_2531: Phosphoglycerate mutase family protein
*
Pseudomonas stutzeri A1501

Site:
position = -146
score = 5.5501
sequence = ATTCAAACAAACGTTCGAAT

Gene: PST_2241: Phosphoglycerate mutase family protein
 
Azotobacter vinelandii AvOP

Gene: Avin_27570: Phosphoglycerate mutase family protein
Phosphoglycerate mutase family protein
scp
 
Pseudomonas aeruginosa PAO1

Gene: PA1830: Sterol-binding domain protein
 
Pseudomonas entomophila L48

Gene: PSEEN2269: Sterol-binding domain protein
 
Pseudomonas putida KT2440

Gene: PP3924: Sterol-binding domain protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2725: Sterol-binding domain protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3669: Sterol-binding domain protein
 
Pseudomonas mendocina ymp

Gene: Pmen_2532: Sterol-binding domain protein
 
Pseudomonas stutzeri A1501

Gene: PST_2242: Sterol-binding domain protein
 
Azotobacter vinelandii AvOP

Gene: Avin_27580: Sterol-binding domain protein
Sterol-binding domain protein
 
CRON 3.
fadH
 
Pseudomonas aeruginosa PAO1

Gene: PA3092: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Pseudomonas entomophila L48

Site:
position = -102
score = 4.90479
sequence = GTTCAAACGCCTGTTTAATG

Gene: PSEEN1703: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Pseudomonas putida KT2440

Site:
position = -54
score = 4.97544
sequence = ATTCAAACGGCTGTTTAATG

Gene: PP2008: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3803: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3969: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudomonas mendocina ymp

Gene: Pmen_2951: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudomonas stutzeri A1501

Gene: PST_1812: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Azotobacter vinelandii AvOP
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
CRON 4.
etfD
*
Pseudomonas aeruginosa PAO1

Site:
position = -122
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: PA2953: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Pseudomonas entomophila L48

Site:
position = -153
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: PSEEN3660: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Pseudomonas putida KT2440

Site:
position = -163
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: PP4203: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -176
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: PFL_1818: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Pseudomonas mendocina ymp

Site:
position = -123
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: Pmen_2708: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Pseudomonas stutzeri A1501

Site:
position = -130
score = 5.90565
sequence = ATTCAAACAAACGTTTGTAT

Gene: PST_2607: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 3
Azotobacter vinelandii AvOP

Gene: Avin_17400: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: Avin_15160: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: Avin_16430: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
CRON 5.
rpoS
*
Pseudomonas aeruginosa PAO1

Site:
position = -427
score = 4.76789
sequence = CCTCAAACGGAAGTTTGAAT

Gene: PA3622: RNA polymerase sigma factor RpoS
*
Pseudomonas entomophila L48

Site:
position = -428
score = 5.10652
sequence = CTTCAAACGGTAGTTTGAAT

Gene: PSEEN4189: RNA polymerase sigma factor RpoS
*
Pseudomonas putida KT2440

Site:
position = -431
score = 5.10652
sequence = CTTCAAACGGTAGTTTGAAT

Gene: PP1623: RNA polymerase sigma factor RpoS
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -427
score = 4.77927
sequence = CCTCAAACGGCAGTTTGAAT

Gene: PSPTO1565: RNA polymerase sigma factor RpoS
*
Pseudomonas fluorescens Pf-5

Site:
position = -429
score = 5.10652
sequence = CTTCAAACGGTAGTTTGAAT

Gene: PFL_1207: RNA polymerase sigma factor RpoS
*
Pseudomonas mendocina ymp

Site:
position = -424
score = 4.78992
sequence = CCTCAAACGGTAGTTTGAAT

Gene: Pmen_3020: RNA polymerase sigma factor RpoS
*
Pseudomonas stutzeri A1501

Site:
position = -421
score = 4.78992
sequence = CCTCAAACGGTAGTTTGAAT

Gene: PST_1572: RNA polymerase sigma factor RpoS
*
Azotobacter vinelandii AvOP

Site:
position = -422
score = 4.77927
sequence = CCTCAAACGGCAGTTTGAAT

Gene: Avin_38680: RNA polymerase sigma factor RpoS
RNA polymerase sigma factor RpoS
 
CRON 6.
algQ
*
Pseudomonas aeruginosa PAO1

Site:
position = -196
score = 5.50388
sequence = GATCAAACATCCGTATGAAT

Gene: PA5255: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
*
Pseudomonas entomophila L48

Site:
position = -182
score = 5.12893
sequence = GATTAAACGCTTGTATGAAC

Gene: PSEEN0159: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
*
Pseudomonas putida KT2440

Site:
position = -182
score = 5.22925
sequence = TATTAAACACTTGTATGAAC

Gene: PP0191: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -180
score = 5.28324
sequence = TATTAAACGCTTGTATGAAC

Gene: PSPTO0134: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
*
Pseudomonas fluorescens Pf-5

Site:
position = -183
score = 5.12893
sequence = GATTAAACGCTTGTATGAAC

Gene: PFL_5997: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
*
Pseudomonas mendocina ymp

Site:
position = -269
score = 5.20337
sequence = GATTAAACGCTCGTATGAAA

Gene: Pmen_0285: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
 
Pseudomonas stutzeri A1501

Gene: PST_0529: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
 
Azotobacter vinelandii AvOP

Gene: Avin_47550: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
 
CRON 7.
fadB
*
Pseudomonas aeruginosa PAO1

Site:
position = -180
score = 5.50878
sequence = AGTCAAACGGGCGTATGAAT

Gene: PA3014: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas entomophila L48

Site:
position = -162
score = 5.7128
sequence = AATCAAACGGGCGTATGAAT

Gene: PSEEN3728: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas putida KT2440

Site:
position = -161
score = 5.7128
sequence = AATCAAACGGGCGTATGAAT

Gene: PP2136: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -180
score = 5.6537
sequence = AATCAAACGGGCGTATGAAA

Gene: PSPTO3517: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas fluorescens Pf-5

Site:
position = -180
score = 5.6537
sequence = AATCAAACGGGCGTATGAAA

Gene: PFL_1940: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas mendocina ymp

Site:
position = -178
score = 5.7128
sequence = AATCAAACGGGCGTATGAAT

Gene: Pmen_1580: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Pseudomonas stutzeri A1501

Site:
position = -155
score = 5.7128
sequence = AATCAAACGGGCGTATGAAT

Gene: PST_1726: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Azotobacter vinelandii AvOP

Gene: Avin_14440: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
fadA
 
Pseudomonas aeruginosa PAO1

Gene: PA3013: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas entomophila L48

Gene: PSEEN3727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas putida KT2440

Gene: PP2137: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3516: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1941: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas mendocina ymp

Gene: Pmen_1581: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Pseudomonas stutzeri A1501

Gene: PST_1727: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Azotobacter vinelandii AvOP

Gene: Avin_14450: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
CRON 8.
PSEEN3648
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -72
score = 5.37759
sequence = TTTCAAACGTATGTTTGAGC

Gene: PSEEN3648: Proteinase inhibitor
*
Pseudomonas putida KT2440

Site:
position = -83
score = 5.52294
sequence = TTTCAAACGACTGTTTGAGC

Gene: PP4195: Proteinase inhibitor
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -68
score = 4.78571
sequence = TTTCAAACAAACGTTTTGAC

Gene: PSPTO2192: Proteinase inhibitor
*
Pseudomonas fluorescens Pf-5

Site:
position = -76
score = 4.51138
sequence = TTTTAAACGGCTGTTTTAGC

Gene: PFL_1826: Proteinase inhibitor
 
Pseudomonas mendocina ymp

Gene: Pmen_2510: Proteinase inhibitor
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_29830: Proteinase inhibitor
Proteinase inhibitor
 
CRON 9.
psrA
*
Pseudomonas aeruginosa PAO1

Site:
position = -45
score = 4.95268
sequence = GCTGAAACGTATGTTTCAAA

Site:
position = -32
score = 5.76096
sequence = TTTCAAACAAGTGTTTGTCA

Gene: PA3006: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas entomophila L48

Site:
position = -45
score = 4.74262
sequence = CCTGAAACGTATGTTTCAAA

Site:
position = -32
score = 5.71344
sequence = TTTCAAACAACTGTTTGTCA

Gene: PSEEN3720: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas putida KT2440

Site:
position = -54
score = 4.95268
sequence = GCTGAAACGTATGTTTCAAA

Site:
position = -41
score = 5.67532
sequence = TTTCAAACACCTGTTTGTCT

Gene: PP2144: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -31
score = 5.63936
sequence = TTTCAAACGTTCGTTTGTTA

Gene: PSPTO3508: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas fluorescens Pf-5

Site:
position = -45
score = 4.74262
sequence = CCTGAAACGTATGTTTCAAA

Site:
position = -32
score = 5.76096
sequence = TTTCAAACAAGTGTTTGTCA

Gene: PFL_1950: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas mendocina ymp

Site:
position = -44
score = 4.95268
sequence = GCTGAAACGTATGTTTCAAA

Site:
position = -31
score = 5.76096
sequence = TTTCAAACAAGTGTTTGTCA

Gene: Pmen_1588: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Pseudomonas stutzeri A1501

Site:
position = -32
score = 5.63491
sequence = TTTCAAACAGTTGTTTGTCT

Gene: PST_1735: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Azotobacter vinelandii AvOP

Gene: Avin_14520: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
CRON 10.
etfB
*
Pseudomonas aeruginosa PAO1

Site:
position = -218
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PA2952: Electron transfer flavoprotein, beta subunit
*
Pseudomonas entomophila L48

Site:
position = -391
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PSEEN3658: Electron transfer flavoprotein, beta subunit
*
Pseudomonas putida KT2440

Site:
position = -392
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PP4202: Electron transfer flavoprotein, beta subunit
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -373
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PSPTO2185: Electron transfer flavoprotein, beta subunit
*
Pseudomonas fluorescens Pf-5

Site:
position = -393
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PFL_1819: Electron transfer flavoprotein, beta subunit
*
Pseudomonas mendocina ymp

Site:
position = -221
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: Pmen_2707: Electron transfer flavoprotein, beta subunit
*
Pseudomonas stutzeri A1501

Site:
position = -323
score = 5.57571
sequence = ATACAAACGTTTGTTTGAAT

Gene: PST_2605: Electron transfer flavoprotein, beta subunit
 2
Azotobacter vinelandii AvOP

Gene: Avin_15180: Electron transfer flavoprotein, beta subunit

Gene: Avin_14280: Electron transfer flavoprotein, beta subunit
Electron transfer flavoprotein, beta subunit
etfA
 
Pseudomonas aeruginosa PAO1

Gene: PA2951: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas entomophila L48

Gene: PSEEN3657: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas putida KT2440

Gene: PP4201: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2186: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1820: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas mendocina ymp

Gene: Pmen_2706: Electron transfer flavoprotein, alpha subunit
 
Pseudomonas stutzeri A1501

Gene: PST_2604: Electron transfer flavoprotein, alpha subunit
 2
Azotobacter vinelandii AvOP

Gene: Avin_15190: Electron transfer flavoprotein, alpha subunit

Gene: Avin_14290: Electron transfer flavoprotein, alpha subunit
Electron transfer flavoprotein, alpha subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD